ZBP1 Rabbit Polyclonal Antibody

Contact us: [email protected]

ZBP1 Polyclonal Antibody
ABP60951-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human ZBP1 protein at amino acid sequence of 21-70 Applications tips:
Description: A polyclonal antibody for detection of ZBP1 from Human. This ZBP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ZBP1 protein at amino acid sequence of 21-70

ZBP1 Polyclonal Antibody
ES11422-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ZBP1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

ZBP1 Polyclonal Antibody
ES11422-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ZBP1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

ZBP1 Rabbit pAb
A13899-100ul	Abclonal	100 ul	EUR 308

ZBP1 Rabbit pAb
A13899-200ul	Abclonal	200 ul	EUR 459

ZBP1 Rabbit pAb
A13899-20ul	Abclonal	20 ul	EUR 183

ZBP1 Rabbit pAb
A13899-50ul	Abclonal	50 ul	EUR 223

ZBP1 Polyclonal Conjugated Antibody
C28403	SAB	100ul	EUR 397

ZBP1 Antibody
24608-100ul	SAB	100ul	EUR 390

ZBP1 antibody
70R-1257	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal ZBP1 antibody raised against the middle region of ZBP1

ZBP1 antibody
70R-21368	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal ZBP1 antibody

ZBP1 Antibody
1-CSB-PA026311GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against ZBP1. Recognizes ZBP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

Rabbit ZBP1 ELISA Kit
ERTZ0008	Abclonal	96Tests	EUR 521

Zbp1/ Rat Zbp1 ELISA Kit
ELI-40534r	Lifescience Market	96 Tests	EUR 886

anti- ZBP1 antibody
FNab09586	FN Test	100µg	EUR 585
Recommended dilution: WB: 1:500-1:5000 IHC: 1:20-1:200 Immunogen: Z-DNA binding protein 1 Uniprot ID: Q9H171 Gene ID: 81030
Description: Antibody raised against ZBP1

Anti-ZBP1 antibody
PAab09586	Lifescience Market	100 ug	EUR 412

Anti-ZBP1 antibody
STJ115838	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a Z-DNA binding protein. The encoded protein plays a role in the innate immune response by binding to foreign DNA and inducing type-I interferon production. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.

Anti-ZBP1 antibody
STJ192580	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to ZBP1

ZBP1 siRNA
20-abx940166	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ZBP1 siRNA
20-abx940167	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Anti-IMP1 / ZBP1 antibody
STJ72253	St John's Laboratory	100 µg	EUR 359

ZBP1 cloning plasmid
CSB-CL861990HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 450 Sequence: atggcccaggctcctgctgacccgggcagagaaggccaccttgaacaaagaatcctgcaggtgctgacagaggctggctccccggtgaaacttgcccagctggtgaaggaatgccaagcacccaagagggagctcaaccaagtcctctaccgaatgaaaaaggagttgaaagtctc Show more
Description: A cloning plasmid for the ZBP1 gene.

ZBP1 cloning plasmid
CSB-CL861990HU2-10ug	Cusabio	10ug	EUR 471
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1290 Sequence: ATGGCCCAGGCTCCTGCTGACCCGGGCAGAGAAGGCCACCTTGAACAAAGAATCCTGCAGGTGCTGACAGAGGCTGGCTCCCCGGTGAAACTTGCCCAGCTGGTGAAGGAATGCCAAGCACCCAAGAGGGAGCTCAACCAAGTCCTCTACCGAATGAAAAAGGAGTTGAAAGTCT Show more
Description: A cloning plasmid for the ZBP1 gene.

Z-DNA Binding Protein 1 (ZBP1) Polyclonal Antibody (Human)
4-PAB552Hu01	Cloud-Clone	EUR 239.00 EUR 2391.00 EUR 598.00 EUR 299.00 EUR 211.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ZBP1 (Arg10~Pro167) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Z-DNA Binding Protein 1 (ZBP1)

Human ZBP1 ELISA Kit
EHZ0008	Abclonal	96Tests	EUR 521

Bovine ZBP1 ELISA Kit
EBZ0008	Abclonal	96Tests	EUR 521

Anserini ZBP1 ELISA Kit
EAZ0008	Abclonal	96Tests	EUR 521

Chicken ZBP1 ELISA Kit
ECKZ0008	Abclonal	96Tests	EUR 521

Canine ZBP1 ELISA Kit
ECZ0008	Abclonal	96Tests	EUR 521

Goat ZBP1 ELISA Kit
EGTZ0008	Abclonal	96Tests	EUR 521

ZBP1 ELISA KIT|Human
EF004355	Lifescience Market	96 Tests	EUR 689

Mouse ZBP1 shRNA Plasmid
20-abx975072	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human ZBP1 shRNA Plasmid
20-abx962944	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Sheep ZBP1 ELISA Kit
ESZ0008	Abclonal	96Tests	EUR 521

Porcine ZBP1 ELISA Kit
EPZ0008	Abclonal	96Tests	EUR 521

Rat ZBP1 ELISA Kit
ERZ0008	Abclonal	96Tests	EUR 521

Monkey ZBP1 ELISA Kit
EMKZ0008	Abclonal	96Tests	EUR 521

Mouse ZBP1 ELISA Kit
EMZ0008	Abclonal	96Tests	EUR 521

pCMV-SPORT6-ZBP1 Plasmid
PVT16562	Lifescience Market	2 ug	EUR 325

pEGFP-N1-FLAG-ZBP1
PVT17949	Lifescience Market	2 ug	EUR 258

pCR-BluntII-TOPO-ZBP1
PVT17971	Lifescience Market	2 ug	EUR 231

pmCherry-N1-Myc-ZBP1
PVT18072	Lifescience Market	2 ug	EUR 258

ZBP1 Recombinant Protein (Human)
RP044914	ABM	100 ug	Ask for price

ZBP1 Recombinant Protein (Human)
RP035122	ABM	100 ug	Ask for price

ZBP1 Recombinant Protein (Mouse)
RP186158	ABM	100 ug	Ask for price

ZBP1 Recombinant Protein (Mouse)
RP186161	ABM	100 ug	Ask for price

Z-DNA Binding Protein 1 (ZBP1) Polyclonal Antibody (Human), APC
4-PAB552Hu01-APC	Cloud-Clone	EUR 333.00 EUR 3113.00 EUR 872.00 EUR 423.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ZBP1 (Arg10~Pro167) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Z-DNA Binding Protein 1 (ZBP1). This antibody is labeled with APC.

Z-DNA Binding Protein 1 (ZBP1) Polyclonal Antibody (Human), Biotinylated
4-PAB552Hu01-Biotin	Cloud-Clone	EUR 303.00 EUR 2341.00 EUR 697.00 EUR 369.00 EUR 216.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ZBP1 (Arg10~Pro167) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Z-DNA Binding Protein 1 (ZBP1). This antibody is labeled with Biotin.

Z-DNA Binding Protein 1 (ZBP1) Polyclonal Antibody (Human), Cy3
4-PAB552Hu01-Cy3	Cloud-Clone	EUR 403.00 EUR 4109.00 EUR 1121.00 EUR 523.00 EUR 245.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ZBP1 (Arg10~Pro167) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Z-DNA Binding Protein 1 (ZBP1). This antibody is labeled with Cy3.

Z-DNA Binding Protein 1 (ZBP1) Polyclonal Antibody (Human), FITC
4-PAB552Hu01-FITC	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ZBP1 (Arg10~Pro167) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Z-DNA Binding Protein 1 (ZBP1). This antibody is labeled with FITC.

Z-DNA Binding Protein 1 (ZBP1) Polyclonal Antibody (Human), HRP
4-PAB552Hu01-HRP	Cloud-Clone	EUR 305.00 EUR 2714.00 EUR 772.00 EUR 383.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ZBP1 (Arg10~Pro167) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Z-DNA Binding Protein 1 (ZBP1). This antibody is labeled with HRP.

Z-DNA Binding Protein 1 (ZBP1) Polyclonal Antibody (Human), PE
4-PAB552Hu01-PE	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ZBP1 (Arg10~Pro167) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Z-DNA Binding Protein 1 (ZBP1). This antibody is labeled with PE.

Z-DNA Binding Protein 1 (ZBP1) Polyclonal Antibody (Human), APC-Cy7
4-PAB552Hu01-APC-Cy7	Cloud-Clone	EUR 547.00 EUR 6106.00 EUR 1624.00 EUR 727.00 EUR 310.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ZBP1 (Arg10~Pro167) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Z-DNA Binding Protein 1 (ZBP1). This antibody is labeled with APC-Cy7.

Z-DNA-Binding Protein 1 (ZBP1) Antibody
20-abx003826	Abbexa	EUR 495.00 EUR 356.00	100 ul 50 ul
Shipped within 5-10 working days.

Z-DNA Binding Protein 1 (ZBP1) Antibody
20-abx102404	Abbexa	EUR 300.00 EUR 133.00 EUR 787.00 EUR 411.00 EUR 258.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Z-Dna Binding Protein 1 (ZBP1) Antibody
20-abx116709	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Z-DNA-Binding Protein 1 (ZBP1) Antibody
abx239586-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Z-DNA-Binding Protein 1 (ZBP1) Antibody
abx412058-01mg	Abbexa	0.1 mg	EUR 537
Shipped within 1 week.

Z-DNA-Binding Protein 1 (ZBP1) Antibody
abx412059-50ug	Abbexa	50 ug	EUR 356
Shipped within 1 week.

Z-DNA-Binding Protein 1 (ZBP1) Antibody
abx430069-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Guinea Pig ZBP1 ELISA Kit
EGZ0008	Abclonal	96Tests	EUR 521

Zbp1 ORF Vector (Mouse) (pORF)
ORF062054	ABM	1.0 ug DNA	EUR 506

Zbp1 ORF Vector (Mouse) (pORF)
ORF062055	ABM	1.0 ug DNA	EUR 506

ZBP1 ORF Vector (Human) (pORF)
ORF011708	ABM	1.0 ug DNA	EUR 95

ZBP1 ORF Vector (Human) (pORF)
ORF014972	ABM	1.0 ug DNA	EUR 354

ZBP1 Western Blot kit (AWBK36711)
AWBK36711	Aviva Systems Biology	10 reactions	EUR 647
Description: Description of target: Species reactivity: Application: Assay info: Sensitivity:

ZBP1 ELISA Kit (Human) (OKCA00862)
OKCA00862	Aviva Systems Biology	96 Wells	EUR 833
Description: Description of target: Participates in the detection by the host's innate immune system of DNA from viral, bacterial or even host origin. Plays a role in host defense against tumors and pathogens. Acts as a cytoplasmic DNA sensor which, when activated, induces the recruitment of TBK1 and IRF3 to its C-terminal region and activates the downstream interferon regulatory factor (IRF) and NF-kappa B transcription factors, leading to type-I interferon production. ZBP1-induced NF-kappaB activation probably involves the recruitment of the RHIM containing kinases RIPK1 and RIPK3.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 5.86 pg/mL

ZBP1 sgRNA CRISPR Lentivector set (Human)
K2660101	ABM	3 x 1.0 ug	EUR 339

Zbp1 sgRNA CRISPR Lentivector set (Mouse)
K4373001	ABM	3 x 1.0 ug	EUR 339

ZBP1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2660102	ABM	1.0 ug DNA	EUR 154

ZBP1 sgRNA CRISPR Lentivector (Human) (Target 2)
K2660103	ABM	1.0 ug DNA	EUR 154

ZBP1 sgRNA CRISPR Lentivector (Human) (Target 3)
K2660104	ABM	1.0 ug DNA	EUR 154

Zbp1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4373002	ABM	1.0 ug DNA	EUR 154

Zbp1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4373003	ABM	1.0 ug DNA	EUR 154

Zbp1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4373004	ABM	1.0 ug DNA	EUR 154

ZBP1 Protein Vector (Mouse) (pPB-C-His)
PV248214	ABM	500 ng	EUR 603

ZBP1 Protein Vector (Mouse) (pPB-N-His)
PV248215	ABM	500 ng	EUR 603

ZBP1 Protein Vector (Mouse) (pPM-C-HA)
PV248216	ABM	500 ng	EUR 603

ZBP1 Protein Vector (Mouse) (pPM-C-His)
PV248217	ABM	500 ng	EUR 603

ZBP1 Protein Vector (Mouse) (pPB-C-His)
PV248218	ABM	500 ng	EUR 603

ZBP1 Protein Vector (Mouse) (pPB-N-His)
PV248219	ABM	500 ng	EUR 603

ZBP1 Protein Vector (Mouse) (pPM-C-HA)
PV248220	ABM	500 ng	EUR 603

ZBP1 Protein Vector (Mouse) (pPM-C-His)
PV248221	ABM	500 ng	EUR 603

ZBP1 Protein Vector (Human) (pPB-C-His)
PV059885	ABM	500 ng	EUR 481

ZBP1 Protein Vector (Human) (pPB-N-His)
PV059886	ABM	500 ng	EUR 481

ZBP1 Protein Vector (Human) (pPM-C-HA)
PV059887	ABM	500 ng	EUR 481

ZBP1 Protein Vector (Human) (pPM-C-His)
PV059888	ABM	500 ng	EUR 481

Recombinant Z-DNA Binding Protein 1 (ZBP1)
4-RPB552Hu01	Cloud-Clone	EUR 530.08 EUR 245.00 EUR 1712.80 EUR 637.60 EUR 1175.20 EUR 418.00 EUR 4132.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9H171 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 19.4kDa Isoelectric Point: 7.9
Description: Recombinant Human Z-DNA Binding Protein 1 expressed in: E.coli

ZBP1 Protein Vector (Human) (pPB-C-His)
PV046829	ABM	500 ng	EUR 329

ZBP1 Protein Vector (Human) (pPB-N-His)
PV046830	ABM	500 ng	EUR 329

ZBP1 Protein Vector (Human) (pPM-C-HA)
PV046831	ABM	500 ng	EUR 329

ZBP1 Protein Vector (Human) (pPM-C-His)
PV046832	ABM	500 ng	EUR 329

Zbp1 3'UTR Luciferase Stable Cell Line
TU122464	ABM	1.0 ml	Ask for price

ZBP1 3'UTR GFP Stable Cell Line
TU078707	ABM	1.0 ml	EUR 2333

Zbp1 3'UTR GFP Stable Cell Line
TU172464	ABM	1.0 ml	Ask for price

Zbp1 3'UTR Luciferase Stable Cell Line
TU223542	ABM	1.0 ml	Ask for price

ZBP1 Rabbit Polyclonal Antibody