Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG

fallback-image

ZBP1 Rabbit Polyclonal Antibody

ZBP1 Rabbit Polyclonal Antibody

Contact us: [email protected]

ZBP1 Polyclonal Antibody

ABP60951-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human ZBP1 protein at amino acid sequence of 21-70
  • Applications tips:
Description: A polyclonal antibody for detection of ZBP1 from Human. This ZBP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ZBP1 protein at amino acid sequence of 21-70

ZBP1 Polyclonal Antibody

ES11422-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ZBP1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

ZBP1 Polyclonal Antibody

ES11422-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ZBP1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

ZBP1 Rabbit pAb

A13899-100ul 100 ul
EUR 308

ZBP1 Rabbit pAb

A13899-200ul 200 ul
EUR 459

ZBP1 Rabbit pAb

A13899-20ul 20 ul
EUR 183

ZBP1 Rabbit pAb

A13899-50ul 50 ul
EUR 223

ZBP1 Polyclonal Conjugated Antibody

C28403 100ul
EUR 397

ZBP1 Antibody

24608-100ul 100ul
EUR 390

ZBP1 antibody

70R-1257 100 ug
EUR 377
Description: Rabbit polyclonal ZBP1 antibody raised against the middle region of ZBP1

ZBP1 antibody

70R-21368 50 ul
EUR 435
Description: Rabbit polyclonal ZBP1 antibody

ZBP1 Antibody

1-CSB-PA026311GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against ZBP1. Recognizes ZBP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

Rabbit ZBP1 ELISA Kit

ERTZ0008 96Tests
EUR 521

Zbp1/ Rat Zbp1 ELISA Kit

ELI-40534r 96 Tests
EUR 886

anti- ZBP1 antibody

FNab09586 100µg
EUR 585
  • Recommended dilution: WB: 1:500-1:5000
  • IHC: 1:20-1:200
  • Immunogen: Z-DNA binding protein 1
  • Uniprot ID: Q9H171
  • Gene ID: 81030
Description: Antibody raised against ZBP1

Anti-ZBP1 antibody

PAab09586 100 ug
EUR 412

Anti-ZBP1 antibody

STJ115838 100 µl
EUR 277
Description: This gene encodes a Z-DNA binding protein. The encoded protein plays a role in the innate immune response by binding to foreign DNA and inducing type-I interferon production. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.

Anti-ZBP1 antibody

STJ192580 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ZBP1

ZBP1 siRNA

20-abx940166
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ZBP1 siRNA

20-abx940167
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Anti-IMP1 / ZBP1 antibody

STJ72253 100 µg
EUR 359

ZBP1 cloning plasmid

CSB-CL861990HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 450
  • Sequence: atggcccaggctcctgctgacccgggcagagaaggccaccttgaacaaagaatcctgcaggtgctgacagaggctggctccccggtgaaacttgcccagctggtgaaggaatgccaagcacccaagagggagctcaaccaagtcctctaccgaatgaaaaaggagttgaaagtctc
  • Show more
Description: A cloning plasmid for the ZBP1 gene.

ZBP1 cloning plasmid

CSB-CL861990HU2-10ug 10ug
EUR 471
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1290
  • Sequence: ATGGCCCAGGCTCCTGCTGACCCGGGCAGAGAAGGCCACCTTGAACAAAGAATCCTGCAGGTGCTGACAGAGGCTGGCTCCCCGGTGAAACTTGCCCAGCTGGTGAAGGAATGCCAAGCACCCAAGAGGGAGCTCAACCAAGTCCTCTACCGAATGAAAAAGGAGTTGAAAGTCT
  • Show more
Description: A cloning plasmid for the ZBP1 gene.

Z-DNA Binding Protein 1 (ZBP1) Polyclonal Antibody (Human)

4-PAB552Hu01
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ZBP1 (Arg10~Pro167)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Z-DNA Binding Protein 1 (ZBP1)

Human ZBP1 ELISA Kit

EHZ0008 96Tests
EUR 521

Bovine ZBP1 ELISA Kit

EBZ0008 96Tests
EUR 521

Anserini ZBP1 ELISA Kit

EAZ0008 96Tests
EUR 521

Chicken ZBP1 ELISA Kit

ECKZ0008 96Tests
EUR 521

Canine ZBP1 ELISA Kit

ECZ0008 96Tests
EUR 521

Goat ZBP1 ELISA Kit

EGTZ0008 96Tests
EUR 521

ZBP1 ELISA KIT|Human

EF004355 96 Tests
EUR 689

Mouse ZBP1 shRNA Plasmid

20-abx975072
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human ZBP1 shRNA Plasmid

20-abx962944
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Sheep ZBP1 ELISA Kit

ESZ0008 96Tests
EUR 521

Porcine ZBP1 ELISA Kit

EPZ0008 96Tests
EUR 521

Rat ZBP1 ELISA Kit

ERZ0008 96Tests
EUR 521

Monkey ZBP1 ELISA Kit

EMKZ0008 96Tests
EUR 521

Mouse ZBP1 ELISA Kit

EMZ0008 96Tests
EUR 521

pCMV-SPORT6-ZBP1 Plasmid

PVT16562 2 ug
EUR 325

pEGFP-N1-FLAG-ZBP1

PVT17949 2 ug
EUR 258

pCR-BluntII-TOPO-ZBP1

PVT17971 2 ug
EUR 231

pmCherry-N1-Myc-ZBP1

PVT18072 2 ug
EUR 258

ZBP1 Recombinant Protein (Human)

RP044914 100 ug Ask for price

ZBP1 Recombinant Protein (Human)

RP035122 100 ug Ask for price

ZBP1 Recombinant Protein (Mouse)

RP186158 100 ug Ask for price

ZBP1 Recombinant Protein (Mouse)

RP186161 100 ug Ask for price

Z-DNA Binding Protein 1 (ZBP1) Polyclonal Antibody (Human), APC

4-PAB552Hu01-APC
  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ZBP1 (Arg10~Pro167)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Z-DNA Binding Protein 1 (ZBP1). This antibody is labeled with APC.

Z-DNA Binding Protein 1 (ZBP1) Polyclonal Antibody (Human), Biotinylated

4-PAB552Hu01-Biotin
  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ZBP1 (Arg10~Pro167)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Z-DNA Binding Protein 1 (ZBP1). This antibody is labeled with Biotin.

Z-DNA Binding Protein 1 (ZBP1) Polyclonal Antibody (Human), Cy3

4-PAB552Hu01-Cy3
  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ZBP1 (Arg10~Pro167)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Z-DNA Binding Protein 1 (ZBP1). This antibody is labeled with Cy3.

Z-DNA Binding Protein 1 (ZBP1) Polyclonal Antibody (Human), FITC

4-PAB552Hu01-FITC
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ZBP1 (Arg10~Pro167)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Z-DNA Binding Protein 1 (ZBP1). This antibody is labeled with FITC.

Z-DNA Binding Protein 1 (ZBP1) Polyclonal Antibody (Human), HRP

4-PAB552Hu01-HRP
  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ZBP1 (Arg10~Pro167)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Z-DNA Binding Protein 1 (ZBP1). This antibody is labeled with HRP.

Z-DNA Binding Protein 1 (ZBP1) Polyclonal Antibody (Human), PE

4-PAB552Hu01-PE
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ZBP1 (Arg10~Pro167)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Z-DNA Binding Protein 1 (ZBP1). This antibody is labeled with PE.

Z-DNA Binding Protein 1 (ZBP1) Polyclonal Antibody (Human), APC-Cy7

4-PAB552Hu01-APC-Cy7
  • EUR 547.00
  • EUR 6106.00
  • EUR 1624.00
  • EUR 727.00
  • EUR 310.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ZBP1 (Arg10~Pro167)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Z-DNA Binding Protein 1 (ZBP1). This antibody is labeled with APC-Cy7.

Z-DNA-Binding Protein 1 (ZBP1) Antibody

20-abx003826
  • EUR 495.00
  • EUR 356.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Z-DNA Binding Protein 1 (ZBP1) Antibody

20-abx102404
  • EUR 300.00
  • EUR 133.00
  • EUR 787.00
  • EUR 411.00
  • EUR 258.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Z-Dna Binding Protein 1 (ZBP1) Antibody

20-abx116709
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Z-DNA-Binding Protein 1 (ZBP1) Antibody

abx239586-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Z-DNA-Binding Protein 1 (ZBP1) Antibody

abx412058-01mg 0.1 mg
EUR 537
  • Shipped within 1 week.

Z-DNA-Binding Protein 1 (ZBP1) Antibody

abx412059-50ug 50 ug
EUR 356
  • Shipped within 1 week.

Z-DNA-Binding Protein 1 (ZBP1) Antibody

abx430069-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Guinea Pig ZBP1 ELISA Kit

EGZ0008 96Tests
EUR 521

Zbp1 ORF Vector (Mouse) (pORF)

ORF062054 1.0 ug DNA
EUR 506

Zbp1 ORF Vector (Mouse) (pORF)

ORF062055 1.0 ug DNA
EUR 506

ZBP1 ORF Vector (Human) (pORF)

ORF011708 1.0 ug DNA
EUR 95

ZBP1 ORF Vector (Human) (pORF)

ORF014972 1.0 ug DNA
EUR 354

ZBP1 Western Blot kit (AWBK36711)

AWBK36711 10 reactions
EUR 647
Description:
  • Description of target:
  • Species reactivity:
  • Application:
  • Assay info:
  • Sensitivity:

ZBP1 ELISA Kit (Human) (OKCA00862)

OKCA00862 96 Wells
EUR 833
Description: Description of target: Participates in the detection by the host's innate immune system of DNA from viral, bacterial or even host origin. Plays a role in host defense against tumors and pathogens. Acts as a cytoplasmic DNA sensor which, when activated, induces the recruitment of TBK1 and IRF3 to its C-terminal region and activates the downstream interferon regulatory factor (IRF) and NF-kappa B transcription factors, leading to type-I interferon production. ZBP1-induced NF-kappaB activation probably involves the recruitment of the RHIM containing kinases RIPK1 and RIPK3.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 5.86 pg/mL

ZBP1 sgRNA CRISPR Lentivector set (Human)

K2660101 3 x 1.0 ug
EUR 339

Zbp1 sgRNA CRISPR Lentivector set (Mouse)

K4373001 3 x 1.0 ug
EUR 339

ZBP1 sgRNA CRISPR Lentivector (Human) (Target 1)

K2660102 1.0 ug DNA
EUR 154

ZBP1 sgRNA CRISPR Lentivector (Human) (Target 2)

K2660103 1.0 ug DNA
EUR 154

ZBP1 sgRNA CRISPR Lentivector (Human) (Target 3)

K2660104 1.0 ug DNA
EUR 154

Zbp1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4373002 1.0 ug DNA
EUR 154

Zbp1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4373003 1.0 ug DNA
EUR 154

Zbp1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4373004 1.0 ug DNA
EUR 154

ZBP1 Protein Vector (Mouse) (pPB-C-His)

PV248214 500 ng
EUR 603

ZBP1 Protein Vector (Mouse) (pPB-N-His)

PV248215 500 ng
EUR 603

ZBP1 Protein Vector (Mouse) (pPM-C-HA)

PV248216 500 ng
EUR 603

ZBP1 Protein Vector (Mouse) (pPM-C-His)

PV248217 500 ng
EUR 603

ZBP1 Protein Vector (Mouse) (pPB-C-His)

PV248218 500 ng
EUR 603

ZBP1 Protein Vector (Mouse) (pPB-N-His)

PV248219 500 ng
EUR 603

ZBP1 Protein Vector (Mouse) (pPM-C-HA)

PV248220 500 ng
EUR 603

ZBP1 Protein Vector (Mouse) (pPM-C-His)

PV248221 500 ng
EUR 603

ZBP1 Protein Vector (Human) (pPB-C-His)

PV059885 500 ng
EUR 481

ZBP1 Protein Vector (Human) (pPB-N-His)

PV059886 500 ng
EUR 481

ZBP1 Protein Vector (Human) (pPM-C-HA)

PV059887 500 ng
EUR 481

ZBP1 Protein Vector (Human) (pPM-C-His)

PV059888 500 ng
EUR 481

Recombinant Z-DNA Binding Protein 1 (ZBP1)

4-RPB552Hu01
  • EUR 530.08
  • EUR 245.00
  • EUR 1712.80
  • EUR 637.60
  • EUR 1175.20
  • EUR 418.00
  • EUR 4132.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9H171
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 19.4kDa
  • Isoelectric Point: 7.9
Description: Recombinant Human Z-DNA Binding Protein 1 expressed in: E.coli

ZBP1 Protein Vector (Human) (pPB-C-His)

PV046829 500 ng
EUR 329

ZBP1 Protein Vector (Human) (pPB-N-His)

PV046830 500 ng
EUR 329

ZBP1 Protein Vector (Human) (pPM-C-HA)

PV046831 500 ng
EUR 329

ZBP1 Protein Vector (Human) (pPM-C-His)

PV046832 500 ng
EUR 329

Zbp1 3'UTR Luciferase Stable Cell Line

TU122464 1.0 ml Ask for price

ZBP1 3'UTR GFP Stable Cell Line

TU078707 1.0 ml
EUR 2333

Zbp1 3'UTR GFP Stable Cell Line

TU172464 1.0 ml Ask for price

Zbp1 3'UTR Luciferase Stable Cell Line

TU223542 1.0 ml Ask for price

ZBP1 Rabbit Polyclonal Antibody

Recent Posts

Categories

January 2022
M T W T F S S
 12
3456789
10111213141516
17181920212223
24252627282930
31  

Pages