Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG


FCRL2 Rabbit Polyclonal Antibody

FCRL2 Rabbit Polyclonal Antibody

Contact us: [email protected]

FCRL2 Polyclonal Antibody

ABP58541-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human FCRL2 protein at amino acid sequence of 130-210
  • Applications tips:
Description: A polyclonal antibody for detection of FCRL2 from Human. This FCRL2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FCRL2 protein at amino acid sequence of 130-210

FCRL2 Polyclonal Antibody

ABP58541-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human FCRL2 protein at amino acid sequence of 130-210
  • Applications tips:
Description: A polyclonal antibody for detection of FCRL2 from Human. This FCRL2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FCRL2 protein at amino acid sequence of 130-210

FCRL2 Polyclonal Antibody

ABP58541-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human FCRL2 protein at amino acid sequence of 130-210
  • Applications tips:
Description: A polyclonal antibody for detection of FCRL2 from Human. This FCRL2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FCRL2 protein at amino acid sequence of 130-210

FCRL2 Polyclonal Antibody

ES11295-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against FCRL2 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

FCRL2 Polyclonal Antibody

ES11295-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against FCRL2 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

FCRL2 Rabbit pAb

A10324-100ul 100 ul
EUR 308

FCRL2 Rabbit pAb

A10324-200ul 200 ul
EUR 459

FCRL2 Rabbit pAb

A10324-20ul 20 ul
EUR 183

FCRL2 Rabbit pAb

A10324-50ul 50 ul
EUR 223

FCRL2 Polyclonal Conjugated Antibody

C27374 100ul
EUR 397

FCRL2 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against FCRL2. Recognizes FCRL2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

FCRL2 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against FCRL2. Recognizes FCRL2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

Anti-FCRL2 antibody

STJ112362 100 µl
EUR 277
Description: This gene encodes a member of the immunoglobulin receptor superfamily and is one of several Fc receptor-like glycoproteins clustered on the long arm of chromosome 1. The encoded protein has four extracellular C2-type immunoglobulin domains, a transmembrane domain and a cytoplasmic domain that contains one immunoreceptor-tyrosine activation motif and two immunoreceptor-tyrosine inhibitory motifs. This protein may be a prognostic marker for chronic lymphocytic leukemia. Alternatively spliced transcript variants have been described, but their biological validity has not been determined.

Anti-FCRL2 antibody

STJ192453 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to FCRL2


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Polyclonal Goat Anti-FCRL2 Antibody (internal region)

APG00975G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-FCRL2 (internal region). This antibody is tested and proven to work in the following applications:

FCRL2 cloning plasmid

CSB-CL853454HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 609
  • Sequence: atgctgctgtggtcattgctggtcatctttgatgcagtcactgaacaggcagattcgctgacccttgtggcgccctcttctgtcttcgaaggagacagcatcgttctgaaatgccagggagaacagaactggaaaattcagaagatggcttaccataaggataacaaagagttatc
  • Show more
Description: A cloning plasmid for the FCRL2 gene.

FCRL2 cloning plasmid

CSB-CL853454HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 768
  • Show more
Description: A cloning plasmid for the FCRL2 gene.

Anti-FCRL2 (aa92-104) antibody

STJ73120 100 µg
EUR 359

Human FCRL2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

FCRL2 Recombinant Protein (Human)

RP012022 100 ug Ask for price

FCRL2 Recombinant Protein (Human)

RP039064 100 ug Ask for price

Human FCRL2 PicoKine ELISA Kit

EK1976 96 wells
EUR 425
Description: For quantitative detection of human FCRL2 in cell culture supernates, serum and plasma (heparin, EDTA).

FCRL2 ORF Vector (Human) (pORF)

ORF004008 1.0 ug DNA
EUR 95

FCRL2 ORF Vector (Human) (pORF)

ORF013022 1.0 ug DNA
EUR 354

Fc Receptor-Like Protein 2 (FCRL2) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fc Receptor-Like Protein 2 (FCRL2) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fc Receptor-Like Protein 2 (FCRL2) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fc Receptor-Like Protein 2 (FCRL2) Antibody

abx432685-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

FCRL2 sgRNA CRISPR Lentivector set (Human)

K0770901 3 x 1.0 ug
EUR 339

FCRL2 sgRNA CRISPR Lentivector (Human) (Target 1)

K0770902 1.0 ug DNA
EUR 154

FCRL2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0770903 1.0 ug DNA
EUR 154

FCRL2 sgRNA CRISPR Lentivector (Human) (Target 3)

K0770904 1.0 ug DNA
EUR 154

FCRL2 Protein Vector (Human) (pPB-C-His)

PV052085 500 ng
EUR 481

FCRL2 Protein Vector (Human) (pPB-N-His)

PV052086 500 ng
EUR 481

FCRL2 Protein Vector (Human) (pPM-C-HA)

PV052087 500 ng
EUR 481

FCRL2 Protein Vector (Human) (pPM-C-His)

PV052088 500 ng
EUR 481

FCRL2 Protein Vector (Human) (pPB-C-His)

PV016029 500 ng
EUR 329

FCRL2 Protein Vector (Human) (pPB-N-His)

PV016030 500 ng
EUR 329

FCRL2 Protein Vector (Human) (pPM-C-HA)

PV016031 500 ng
EUR 329

FCRL2 Protein Vector (Human) (pPM-C-His)

PV016032 500 ng
EUR 329

FCRL2 3'UTR GFP Stable Cell Line

TU057849 1.0 ml
EUR 1394

FCRL2 3'UTR Luciferase Stable Cell Line

TU007849 1.0 ml
EUR 1394

FCRL2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV705399 1.0 ug DNA
EUR 450

FCRL2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV705403 1.0 ug DNA
EUR 450

FCRL2 Rabbit Polyclonal Antibody

Recent Posts


January 2022
