FCRL2 Rabbit Polyclonal Antibody

Contact us: [email protected]

FCRL2 Polyclonal Antibody
ABP58541-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human FCRL2 protein at amino acid sequence of 130-210 Applications tips:
Description: A polyclonal antibody for detection of FCRL2 from Human. This FCRL2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FCRL2 protein at amino acid sequence of 130-210

FCRL2 Polyclonal Antibody
ABP58541-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human FCRL2 protein at amino acid sequence of 130-210 Applications tips:
Description: A polyclonal antibody for detection of FCRL2 from Human. This FCRL2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FCRL2 protein at amino acid sequence of 130-210

FCRL2 Polyclonal Antibody
ABP58541-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human FCRL2 protein at amino acid sequence of 130-210 Applications tips:
Description: A polyclonal antibody for detection of FCRL2 from Human. This FCRL2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FCRL2 protein at amino acid sequence of 130-210

FCRL2 Polyclonal Antibody
ES11295-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against FCRL2 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

FCRL2 Polyclonal Antibody
ES11295-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against FCRL2 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

FCRL2 Rabbit pAb
A10324-100ul	Abclonal	100 ul	EUR 308

FCRL2 Rabbit pAb
A10324-200ul	Abclonal	200 ul	EUR 459

FCRL2 Rabbit pAb
A10324-20ul	Abclonal	20 ul	EUR 183

FCRL2 Rabbit pAb
A10324-50ul	Abclonal	50 ul	EUR 223

FCRL2 Polyclonal Conjugated Antibody
C27374	SAB	100ul	EUR 397

FCRL2 Antibody
1-CSB-PA853454ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against FCRL2. Recognizes FCRL2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

FCRL2 Antibody
1-CSB-PA853454ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against FCRL2. Recognizes FCRL2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

Anti-FCRL2 antibody
STJ112362	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the immunoglobulin receptor superfamily and is one of several Fc receptor-like glycoproteins clustered on the long arm of chromosome 1. The encoded protein has four extracellular C2-type immunoglobulin domains, a transmembrane domain and a cytoplasmic domain that contains one immunoreceptor-tyrosine activation motif and two immunoreceptor-tyrosine inhibitory motifs. This protein may be a prognostic marker for chronic lymphocytic leukemia. Alternatively spliced transcript variants have been described, but their biological validity has not been determined.

Anti-FCRL2 antibody
STJ192453	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to FCRL2

FCRL2 siRNA
20-abx916713	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Polyclonal Goat Anti-FCRL2 Antibody (internal region)
APG00975G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-FCRL2 (internal region). This antibody is tested and proven to work in the following applications:

FCRL2 cloning plasmid
CSB-CL853454HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 609 Sequence: atgctgctgtggtcattgctggtcatctttgatgcagtcactgaacaggcagattcgctgacccttgtggcgccctcttctgtcttcgaaggagacagcatcgttctgaaatgccagggagaacagaactggaaaattcagaagatggcttaccataaggataacaaagagttatc Show more
Description: A cloning plasmid for the FCRL2 gene.

FCRL2 cloning plasmid
CSB-CL853454HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 768 Sequence: ATGTGGGAATGGAAAATATGCAACAGCCATGGGGCCAGGCCCTTTGCTGAGCCTGCAGGTTGGGAGTTTGTGAATCTATTGAGGCATCACAAATCTTTTCTGATAGCCCCTCTGTGTCTGTCAGTTCCAGTGTCTCGCCCTGTCCTCACCCTCAGGTCTCCTGGGGCCCAGGCTGC Show more
Description: A cloning plasmid for the FCRL2 gene.

Anti-FCRL2 (aa92-104) antibody
STJ73120	St John's Laboratory	100 µg	EUR 359

Human FCRL2 shRNA Plasmid
20-abx962374	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

FCRL2 Recombinant Protein (Human)
RP012022	ABM	100 ug	Ask for price

FCRL2 Recombinant Protein (Human)
RP039064	ABM	100 ug	Ask for price

Human FCRL2 PicoKine ELISA Kit
EK1976	BosterBio	96 wells	EUR 425
Description: For quantitative detection of human FCRL2 in cell culture supernates, serum and plasma (heparin, EDTA).

FCRL2 ORF Vector (Human) (pORF)
ORF004008	ABM	1.0 ug DNA	EUR 95

FCRL2 ORF Vector (Human) (pORF)
ORF013022	ABM	1.0 ug DNA	EUR 354

Fc Receptor-Like Protein 2 (FCRL2) Antibody
20-abx125841	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Fc Receptor-Like Protein 2 (FCRL2) Antibody
20-abx321221	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Fc Receptor-Like Protein 2 (FCRL2) Antibody
20-abx322029	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Fc Receptor-Like Protein 2 (FCRL2) Antibody
abx432685-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

FCRL2 sgRNA CRISPR Lentivector set (Human)
K0770901	ABM	3 x 1.0 ug	EUR 339

FCRL2 sgRNA CRISPR Lentivector (Human) (Target 1)
K0770902	ABM	1.0 ug DNA	EUR 154

FCRL2 sgRNA CRISPR Lentivector (Human) (Target 2)
K0770903	ABM	1.0 ug DNA	EUR 154

FCRL2 sgRNA CRISPR Lentivector (Human) (Target 3)
K0770904	ABM	1.0 ug DNA	EUR 154

FCRL2 Protein Vector (Human) (pPB-C-His)
PV052085	ABM	500 ng	EUR 481

FCRL2 Protein Vector (Human) (pPB-N-His)
PV052086	ABM	500 ng	EUR 481

FCRL2 Protein Vector (Human) (pPM-C-HA)
PV052087	ABM	500 ng	EUR 481

FCRL2 Protein Vector (Human) (pPM-C-His)
PV052088	ABM	500 ng	EUR 481

FCRL2 Protein Vector (Human) (pPB-C-His)
PV016029	ABM	500 ng	EUR 329

FCRL2 Protein Vector (Human) (pPB-N-His)
PV016030	ABM	500 ng	EUR 329

FCRL2 Protein Vector (Human) (pPM-C-HA)
PV016031	ABM	500 ng	EUR 329

FCRL2 Protein Vector (Human) (pPM-C-His)
PV016032	ABM	500 ng	EUR 329

FCRL2 3'UTR GFP Stable Cell Line
TU057849	ABM	1.0 ml	EUR 1394

FCRL2 3'UTR Luciferase Stable Cell Line
TU007849	ABM	1.0 ml	EUR 1394

FCRL2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV705399	ABM	1.0 ug DNA	EUR 450

FCRL2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV705403	ABM	1.0 ug DNA	EUR 450

FCRL2 Rabbit Polyclonal Antibody