Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG

fallback-image

GPNMB Rabbit Polyclonal Antibody

GPNMB Rabbit Polyclonal Antibody

Contact us: [email protected]

GPNMB Polyclonal Antibody

ES11148-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against GPNMB from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

GPNMB Rabbit pAb

A14270-100ul 100 ul
EUR 308

GPNMB Rabbit pAb

A14270-200ul 200 ul
EUR 459

GPNMB Rabbit pAb

A14270-20ul 20 ul
EUR 183

GPNMB Rabbit pAb

A14270-50ul 50 ul
EUR 223

Anti-GPNMB/Gpnmb Antibody

A02439-1 100ug/vial
EUR 334

GPNMB antibody

70R-17568 50 ul
EUR 435
Description: Rabbit polyclonal GPNMB antibody

GPNMB Antibody

48438-100ul 100ul
EUR 333

GPNMB Antibody

48438-50ul 50ul
EUR 239

GPNMB Antibody

DF12621 200ul
EUR 304
Description: GPNMB Antibody detects endogenous levels of GPNMB.

GPNMB Antibody

1-CSB-PA009727GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against GPNMB. Recognizes GPNMB from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

Polyclonal GPNMB Antibody (C-term)

APR04194G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPNMB (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal GPNMB antibody - N-terminal region

APR00922G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPNMB - N-terminal region. This antibody is tested and proven to work in the following applications:

GPNMB Conjugated Antibody

C48438 100ul
EUR 397

anti- GPNMB antibody

FNab03586 100µg
EUR 548.75
  • Immunogen: glycoprotein(transmembrane) nmb
  • Uniprot ID: Q14956
  • Gene ID: 10457
  • Research Area: Neuroscience
Description: Antibody raised against GPNMB

Anti-GPNMB antibody

PAab03586 100 ug
EUR 386

Anti-GPNMB antibody

STJ116483 100 µl
EUR 277
Description: The protein encoded by this gene is a type I transmembrane glycoprotein which shows homology to the pMEL17 precursor, a melanocyte-specific protein. GPNMB shows expression in the lowly metastatic human melanoma cell lines and xenografts but does not show expression in the highly metastatic cell lines. GPNMB may be involved in growth delay and reduction of metastatic potential. Two transcript variants encoding different isoforms have been found for this gene.

Anti-GPNMB antibody

STJ192306 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to GPNMB

GPNMB siRNA

20-abx918396
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GPNMB siRNA

20-abx918397
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-GPNMB

YF-PA25580 50 ul
EUR 334
Description: Mouse polyclonal to GPNMB

GPNMB Blocking Peptide

DF12621-BP 1mg
EUR 195

GPNMB cloning plasmid

CSB-CL622928HU1-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1719
  • Sequence: atggaatgtctctactatttcctgggatttctgctcctggctgcaagattgccacttgatgccgccaaacgatttcatgatgtgctgggcaatgaaagaccttctgcttacatgagggagcacaatcaattaaatggctggtcttctgatgaaaatgactggaatgaaaaactct
  • Show more
Description: A cloning plasmid for the GPNMB gene.

GPNMB cloning plasmid

CSB-CL622928HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 621
  • Sequence: atggaatgtctctactatttcctgggatttctgctcctggctgcaagattgccacttgatgccgccaaacgatttcatgatgtgctgggcaatgaaagaccttctgcttacatgagggagcacaatcaattaaatggctggtcttctgatgaaaatgactggaatgaaaaactcta
  • Show more
Description: A cloning plasmid for the GPNMB gene.

pDONR223-GPNMB Plasmid

PVTB00922 2 ug
EUR 356

Anti-GPNMB (1A8)

YF-MA17316 100 ug
EUR 363
Description: Mouse monoclonal to GPNMB

Anti-GPNMB (3A5)

YF-MA17317 100 ug
EUR 363
Description: Mouse monoclonal to GPNMB

Transmembrane Glycoprotein NMB (GPNMB) Antibody

abx015876-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

Transmembrane Glycoprotein NMB (GPNMB) Antibody

20-abx112810
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Transmembrane Glycoprotein NMB (GPNMB) Antibody

abx340162-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Transmembrane Glycoprotein NMB (GPNMB) Antibody

abx233586-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Monoclonal GPNMB Antibody, Clone: 7C10E5

AMM02939G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human GPNMB. The antibodies are raised in Mouse and are from clone 7C10E5. This antibody is applicable in WB and IHC, E

Human Transmembrane Glycoprotein NMB (GPNMB) Antibody

31177-05111 150 ug
EUR 261

GPNMB protein (His tag)

80R-2986 100 ug
EUR 327
Description: Purified recombinant GPNMB protein (His tag)

GPNMB ELISA KIT|Human

EF005385 96 Tests
EUR 689

Human GPNMB shRNA Plasmid

20-abx957095
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse GPNMB shRNA Plasmid

20-abx979218
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

h GPNMB Expression Lentivirus

LVP921 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made over-expression lentivirus for human target: GPNMB, containing a RFP-Blasticidin dual selection marker.

Recombinant Human GPNMB Protein

RP00263 10 μg
EUR 155

GPNMB Recombinant Protein (Human)

RP013774 100 ug Ask for price

GPNMB Recombinant Protein (Human)

RP013777 100 ug Ask for price

GPNMB Recombinant Protein (Rat)

RP203258 100 ug Ask for price

GPNMB Recombinant Protein (Mouse)

RP139382 100 ug Ask for price

Monoclonal GPNMB Antibody (monoclonal) (M01), Clone: 1A8

AMM03589G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human GPNMB (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1A8. This antibody is applicable in WB, E

Anti-GPNMB-VC-MMAE ADC

ADC-W-462 1mg Ask for price
Description: This ADC product is comprised of an anti-GPNMB monoclonal antibody conjugated via a VC linker to MMAF

Gpnmb ORF Vector (Rat) (pORF)

ORF067754 1.0 ug DNA
EUR 506

GPNMB ORF Vector (Human) (pORF)

ORF004592 1.0 ug DNA
EUR 95

GPNMB ORF Vector (Human) (pORF)

ORF004593 1.0 ug DNA
EUR 95

Gpnmb ORF Vector (Mouse) (pORF)

ORF046462 1.0 ug DNA
EUR 506

pCMV-SPORT6.ccdb-Gpnmb-r

PVT18903 2 ug
EUR 231

GPNMB ELISA Kit (Rat) (OKCA02605)

OKCA02605 96 Wells
EUR 846
Description: Description of target: Could be a melanogenic enzyme.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 1.95 pg/mL

GPNMB ELISA Kit (Rat) (OKEH06011)

OKEH06011 96 Wells
EUR 662
Description: Description of target: Could be a melanogenic enzyme.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.188 ng/mL

Human Transmembrane Glycoprotein NMB (GPNMB) Antibody (Biotin Conjugate)

31177-05121 150 ug
EUR 369

Human CellExp? Osteoactivin / GPNMB, human recombinant

7513-10
EUR 245

ELISA kit for Human GPNMB/Osteoactivin

EK5557 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human GPNMB/Osteoactivin in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Mouse GPNMB/Osteoactivin

EK5608 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse GPNMB/Osteoactivin in samples from serum, plasma, tissue homogenates and other biological fluids.

Human GPNMB/Osteoactivin PicoKine ELISA Kit

EK1251 96 wells
EUR 425
Description: For quantitative detection of human GPNMB in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Mouse Osteoactivin/GPNMB PicoKine ELISA Kit

EK1331 96 wells
EUR 425
Description: For quantitative detection of mouse Osteoactivin in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Recombinant Human Osteoactivin/GPNMB (C-6His)

C497-10ug 10ug
EUR 131
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2.

Recombinant Human Osteoactivin/GPNMB (C-6His)

C497-1mg 1mg
EUR 2283
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2.

Recombinant Human Osteoactivin/GPNMB (C-6His)

C497-500ug 500ug
EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2.

Recombinant Human Osteoactivin/GPNMB (C-6His)

C497-50ug 50ug
EUR 273
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2.

Anti-GPNMB (Glembatumumab)-SMCC-DM1 ADC

ADC-W-2598 1mg Ask for price
Description: This ADC product is comprised of an anti-GPNMB monoclonal antibody conjugated via a SMCC linker to DM1

Anti-GPNMB (Glembatumumab)-SPDB-DM4 ADC

ADC-W-2599 1mg Ask for price
Description: This ADC product is comprised of an anti-GPNMB monoclonal antibody conjugated via a SPDB linker to DM4

Anti-GPNMB (Glembatumumab)-MC-MMAF ADC

ADC-W-2600 1mg Ask for price
Description: This ADC product is comprised of an anti-GPNMB monoclonal antibody conjugated via a MC linker to MMAF

Gpnmb sgRNA CRISPR Lentivector set (Rat)

K7535601 3 x 1.0 ug
EUR 339

Gpnmb sgRNA CRISPR Lentivector set (Mouse)

K4377601 3 x 1.0 ug
EUR 339

GPNMB sgRNA CRISPR Lentivector set (Human)

K0888701 3 x 1.0 ug
EUR 339

GPNMB Glycoprotein Nmb Human Recombinant Protein

PROTQ14956-1 Regular: 20ug
EUR 317
Description: GPNMB Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 476 amino acids (22-474) and having a molecular mass of 53.2 kDa.;GPNMB is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

GPNMB Rabbit Polyclonal Antibody

Recent Posts

Categories

January 2022
M T W T F S S
 12
3456789
10111213141516
17181920212223
24252627282930
31  

Pages