Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG

fallback-image

SPAG8 Rabbit Polyclonal Antibody

SPAG8 Rabbit Polyclonal Antibody

Contact us: [email protected]

SPAG8 Polyclonal Antibody
ABP60486-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human SPAG8 protein
  • Applications tips:
Description: A polyclonal antibody for detection of SPAG8 from Human . This SPAG8 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SPAG8 protein
SPAG8 Polyclonal Antibody
ABP60486-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human SPAG8 protein
  • Applications tips:
Description: A polyclonal antibody for detection of SPAG8 from Human . This SPAG8 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SPAG8 protein
SPAG8 Polyclonal Antibody
ABP60486-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human SPAG8 protein
  • Applications tips:
Description: A polyclonal antibody for detection of SPAG8 from Human . This SPAG8 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SPAG8 protein
SPAG8 Polyclonal Antibody
ES11041-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against SPAG8 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
SPAG8 Polyclonal Antibody
ES11041-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against SPAG8 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
SPAG8 Rabbit pAb
A8943-100ul 100 ul
EUR 308
SPAG8 Rabbit pAb
A8943-200ul 200 ul
EUR 459
SPAG8 Rabbit pAb
A8943-20ul 20 ul
EUR 183
SPAG8 Rabbit pAb
A8943-50ul 50 ul
EUR 223
SPAG8 antibody
70R-20476 50 ul
EUR 435
Description: Rabbit polyclonal SPAG8 antibody
SPAG8 antibody
70R-2385 50 ug
EUR 467
Description: Rabbit polyclonal SPAG8 antibody raised against the N terminal of SPAG8
SPAG8 antibody
70R-2386 50 ug
EUR 467
Description: Rabbit polyclonal SPAG8 antibody raised against the middle region of SPAG8
SPAG8 Antibody
35927-100ul 100ul
EUR 252
SPAG8 Antibody
1-CSB-PA858730LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SPAG8. Recognizes SPAG8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200
SPAG8 Antibody
1-CSB-PA269500
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SPAG8. Recognizes SPAG8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:25-1:100
SPAG8 Antibody
1-CSB-PA209919
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SPAG8. Recognizes SPAG8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:25-1:100
SPAG8 Antibody
1-CSB-PA022469GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SPAG8. Recognizes SPAG8 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
SPAG8 Polyclonal Antibody, HRP Conjugated
A69156 100 ?g
EUR 628.55
Description: kits suitable for this type of research
SPAG8 Polyclonal Antibody, FITC Conjugated
A69157 100 ?g
EUR 628.55
Description: fast delivery possible
SPAG8 Polyclonal Antibody, Biotin Conjugated
A69158 100 ?g
EUR 628.55
Description: reagents widely cited
SPAG8 Conjugated Antibody
C35927 100ul
EUR 397
anti- SPAG8 antibody
FNab08146 100µg
EUR 548.75
  • Immunogen: sperm associated antigen 8
  • Uniprot ID: Q99932
  • Gene ID: 26206
  • Research Area: Stem Cells
Description: Antibody raised against SPAG8
Anti-SPAG8 antibody
PAab08146 100 ug
EUR 386
Anti-SPAG8 antibody
STJ113600 100 µl
EUR 277
Description: The correlation of anti-sperm antibodies with cases of unexplained infertility implicates a role for these antibodies in blocking fertilization. Improved diagnosis and treatment of immunologic infertility, as well as identification of proteins for targeted contraception, are dependent on the identification and characterization of relevant sperm antigens. The protein encoded by this gene is recognized by sperm agglutinating antibodies from an infertile woman. This protein is localized in germ cells of the testis at all stages of spermatogenesis and is localized to the acrosomal region of mature spermatozoa. This protein interacts with ACT (activator of CREM in testis) and may play a role in CREM (cAMP response element modulator)-ACT-mediated gene transcription during spermatogenesis. This protein may also play a role in spermatogenesis by regulating microtubule formation and cell division. Alternatively spliced variants that encode different protein isoforms have been described but the full-length sequences of only two have been determined.
Anti-SPAG8 antibody
STJ192199 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SPAG8
SPAG8 siRNA
20-abx934799
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
pBlueScriptR-SPAG8
PVT17301 2 ug
EUR 231
anti-SPAG8
YF-PA18238 50 ul
EUR 363
Description: Mouse polyclonal to SPAG8
anti-SPAG8
YF-PA18239 50 ug
EUR 363
Description: Mouse polyclonal to SPAG8
SPAG8 Antibody, HRP conjugated
1-CSB-PA858730LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SPAG8. Recognizes SPAG8 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
SPAG8 Antibody, FITC conjugated
1-CSB-PA858730LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SPAG8. Recognizes SPAG8 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
SPAG8 Antibody, Biotin conjugated
1-CSB-PA858730LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SPAG8. Recognizes SPAG8 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
SPAG8 Blocking Peptide
33R-8479 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SPAG8 antibody, catalog no. 70R-2385
SPAG8 Blocking Peptide
33R-6974 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SPAG8 antibody, catalog no. 70R-2386
SPAG8 cloning plasmid
CSB-CL858730HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1506
  • Sequence: atggagaccaacgggtctacggagggatcgcggtcgcggtcgcgatctttagacatacagcccagctccgaaggactggggcccacttcggaaccgtttccttcttcagatgacagtcccaggtcggccctggcagctgcaaccgcagcagctgcagcggctgcatcagctgctg
  • Show more
Description: A cloning plasmid for the SPAG8 gene.
Anti-SPAG8 (2F12)
YF-MA18062 100 ug
EUR 363
Description: Mouse monoclonal to SPAG8
SPAG8 ELISA KIT|Human
EF003162 96 Tests
EUR 689
Human SPAG8 shRNA Plasmid
20-abx958755
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
SPAG8 Recombinant Protein (Rat)
RP230627 100 ug Ask for price
SPAG8 Recombinant Protein (Human)
RP029767 100 ug Ask for price
SPAG8 Recombinant Protein (Mouse)
RP174728 100 ug Ask for price
Sperm Associated Antigen 8 (SPAG8) Antibody
20-abx115763
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Sperm-Associated Antigen 8 (SPAG8) Antibody
abx122908-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Sperm-Associated Antigen 8 (SPAG8) Antibody
20-abx124599
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Sperm-Associated Antigen 8 (SPAG8) Antibody
abx238146-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Sperm-Associated Antigen 8 (SPAG8) Antibody
20-abx339750
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Sperm-Associated Antigen 8 (SPAG8) Antibody
20-abx339751
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Sperm-Associated Antigen 8 (SPAG8) Antibody
20-abx333753
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Sperm-Associated Antigen 8 (SPAG8) Antibody (HRP)
20-abx337781
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Sperm-Associated Antigen 8 (SPAG8) Antibody (FITC)
20-abx337782
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Sperm-Associated Antigen 8 (SPAG8) Antibody (Biotin)
20-abx337783
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Spag8 ORF Vector (Rat) (pORF)
ORF076877 1.0 ug DNA
EUR 506
SPAG8 ORF Vector (Human) (pORF)
ORF009923 1.0 ug DNA
EUR 95
Spag8 ORF Vector (Mouse) (pORF)
ORF058244 1.0 ug DNA
EUR 506
Spag8 sgRNA CRISPR Lentivector set (Rat)
K6142601 3 x 1.0 ug
EUR 339
Spag8 sgRNA CRISPR Lentivector set (Mouse)
K3028801 3 x 1.0 ug
EUR 339
SPAG8 sgRNA CRISPR Lentivector set (Human)
K2264601 3 x 1.0 ug
EUR 339
Spag8 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6142602 1.0 ug DNA
EUR 154
Spag8 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6142603 1.0 ug DNA
EUR 154
Spag8 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6142604 1.0 ug DNA
EUR 154
Spag8 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3028802 1.0 ug DNA
EUR 154
Spag8 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3028803 1.0 ug DNA
EUR 154
Spag8 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3028804 1.0 ug DNA
EUR 154
SPAG8 sgRNA CRISPR Lentivector (Human) (Target 1)
K2264602 1.0 ug DNA
EUR 154
SPAG8 sgRNA CRISPR Lentivector (Human) (Target 2)
K2264603 1.0 ug DNA
EUR 154
SPAG8 sgRNA CRISPR Lentivector (Human) (Target 3)
K2264604 1.0 ug DNA
EUR 154
SPAG8 Protein Vector (Rat) (pPB-C-His)
PV307506 500 ng
EUR 603
SPAG8 Protein Vector (Rat) (pPB-N-His)
PV307507 500 ng
EUR 603
SPAG8 Protein Vector (Rat) (pPM-C-HA)
PV307508 500 ng
EUR 603
SPAG8 Protein Vector (Rat) (pPM-C-His)
PV307509 500 ng
EUR 603
SPAG8 Protein Vector (Human) (pPB-C-His)
PV039689 500 ng
EUR 329
SPAG8 Protein Vector (Human) (pPB-N-His)
PV039690 500 ng
EUR 329
SPAG8 Protein Vector (Human) (pPM-C-HA)
PV039691 500 ng
EUR 329
SPAG8 Protein Vector (Human) (pPM-C-His)
PV039692 500 ng
EUR 329
SPAG8 Protein Vector (Mouse) (pPB-C-His)
PV232974 500 ng
EUR 603
SPAG8 Protein Vector (Mouse) (pPB-N-His)
PV232975 500 ng
EUR 603
SPAG8 Protein Vector (Mouse) (pPM-C-HA)
PV232976 500 ng
EUR 603
SPAG8 Protein Vector (Mouse) (pPM-C-His)
PV232977 500 ng
EUR 603
Spag8 3'UTR Luciferase Stable Cell Line
TU119522 1.0 ml Ask for price
Spag8 3'UTR GFP Stable Cell Line
TU169522 1.0 ml Ask for price
Spag8 3'UTR Luciferase Stable Cell Line
TU221024 1.0 ml Ask for price
Spag8 3'UTR GFP Stable Cell Line
TU271024 1.0 ml Ask for price
SPAG8 3'UTR GFP Stable Cell Line
TU074378 1.0 ml
EUR 1521
SPAG8 3'UTR Luciferase Stable Cell Line
TU024378 1.0 ml
EUR 1521
Human Sperm- associated antigen 8, SPAG8 ELISA KIT
ELI-29622h 96 Tests
EUR 824
Human Sperm-Associated Antigen 8 (SPAG8) ELISA Kit
abx383397-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252
GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187
EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252
EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187
Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252
Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187
ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252
ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187
EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252
EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187
mOrange Rabbit Polyclonal Antibody
38079-100ul 100ul
EUR 252
mOrange Rabbit Polyclonal Antibody
38079-50ul 50ul
EUR 187
mStrawberry Rabbit Polyclonal Antibody
38083-100ul 100ul
EUR 252

SPAG8 Rabbit Polyclonal Antibody

Recent Posts

Categories

January 2022
M T W T F S S
 12
3456789
10111213141516
17181920212223
24252627282930
31  

Pages