Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG

fallback-image

C1D Rabbit Polyclonal Antibody

C1D Rabbit Polyclonal Antibody

Contact us: [email protected]

C1D Polyclonal Antibody

ES11140-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against C1D from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

C1D Polyclonal Antibody

ES11140-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against C1D from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

C1D Rabbit pAb

A6448-100ul 100 ul
EUR 308

C1D Rabbit pAb

A6448-200ul 200 ul
EUR 459

C1D Rabbit pAb

A6448-20ul 20 ul
EUR 183

C1D Rabbit pAb

A6448-50ul 50 ul
EUR 223

C1D antibody

70R-16071 50 ul
EUR 435
Description: Rabbit polyclonal C1D antibody

C1D antibody

70R-15387 100 ug
EUR 327
Description: Rabbit polyclonal C1D antibody

C1D antibody

38926-100ul 100ul
EUR 252

C1D Antibody

1-CSB-PA003488GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against C1D. Recognizes C1D from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

C1D Antibody

1-CSB-PA03474A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against C1D. Recognizes C1D from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:100-1:500, IF:1:500-1:1000

C1D antibody

70R-8923 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal C1D antibody

C1D antibody

70R-8924 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal C1D antibody

Polyclonal C1D Antibody (aa1-135)

APR03350G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human C1D (aa1-135). This antibody is tested and proven to work in the following applications:

Polyclonal Goat Anti-C1D Antibody

APG00052G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-C1D . This antibody is tested and proven to work in the following applications:

C1D Polyclonal Antibody, HRP Conjugated

A56636 100 µg
EUR 570.55
Description: The best epigenetics products

C1D Polyclonal Antibody, FITC Conjugated

A56637 100 µg
EUR 570.55
Description: kits suitable for this type of research

C1D Polyclonal Antibody, Biotin Conjugated

A56638 100 µg
EUR 570.55
Description: fast delivery possible

C1D

PR27269 2 ug
EUR 191

C1D antibody (HRP)

60R-1981 100 ug
EUR 327
Description: Rabbit polyclonal C1D antibody (HRP)

C1D antibody (FITC)

60R-1982 100 ug
EUR 327
Description: Rabbit polyclonal C1D antibody (FITC)

C1D antibody (biotin)

60R-1983 100 ug
EUR 327
Description: Rabbit polyclonal C1D antibody (biotin)

C1D Conjugated Antibody

C38926 100ul
EUR 397

anti- C1D antibody

FNab01056 100µg
EUR 548.75
  • Recommended dilution: IHC: 1:50-1:500
  • Immunogen: C1D nuclear receptor co-repressor
  • Uniprot ID: Q13901
  • Gene ID: 10438
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against C1D

Anti-C1D antibody

PAab01056 100 ug
EUR 386

Anti-C1D antibody

STJ28531 100 µl
EUR 277
Description: The protein encoded by this gene is a DNA binding and apoptosis-inducing protein and is localized in the nucleus. It is also a Rac3-interacting protein which acts as a corepressor for the thyroid hormone receptor. This protein is thought to regulate TRAX/Translin complex formation. Alternate splicing results in multiple transcript variants that encode the same protein. Multiple pseudogenes of this gene are found on chromosome 10.

Anti-C1D antibody

STJ71783 100 µg
EUR 359

Anti-C1D antibody

STJ192298 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to C1D

Nuclear Nucleic Acid-Binding Protein C1D (C1D) Antibody

20-abx004941
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Nuclear Nucleic Acid-Binding Protein C1D (C1D) Antibody

20-abx111283
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Nuclear Nucleic Acid-Binding Protein C1D (C1D) Antibody

20-abx109339
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Nuclear Nucleic Acid-Binding Protein C1D (C1D) Antibody

abx432429-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Nuclear Nucleic Acid-Binding Protein C1D (C1D) Antibody

abx231056-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

C1D siRNA

20-abx909636
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

C1D siRNA

20-abx909637
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-C1D

YF-PA25576 50 ul
EUR 334
Description: Mouse polyclonal to C1D

Nuclear Nucleic Acid-Binding Protein C1D (C1D) Antibody (Biotin)

20-abx105727
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Nuclear Nucleic Acid-Binding Protein C1D (C1D) Antibody (FITC)

20-abx107145
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Nuclear Nucleic Acid-Binding Protein C1D (C1D) Antibody (HRP)

20-abx108566
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

C1D Antibody, HRP conjugated

1-CSB-PA03474B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against C1D. Recognizes C1D from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

C1D Antibody, FITC conjugated

1-CSB-PA03474C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against C1D. Recognizes C1D from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

C1D Antibody, Biotin conjugated

1-CSB-PA03474D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against C1D. Recognizes C1D from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human Nuclear nucleic acid-binding protein C1D (C1D)

1-CSB-RP034744h
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 42.4 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Nuclear nucleic acid-binding protein C1D(C1D),partial expressed in E.coli

Nuclear Nucleic Acid-Binding Protein C1D (C1D) Protein

20-abx262625
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

C1D Blocking Peptide

33R-4854 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of C1D antibody, catalog no. 70R-8924

C1D Blocking Peptide

33R-1192 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RPL6 antibody, catalog no. 70R-1441

C1D cloning plasmid

CSB-CL623834HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 426
  • Sequence: atggcaggtgaagaaattaatgaagactatccagtagaaattcacgagtatttgtcagcgtttgagaattccattggtgctgtggatgagatgctgaagaccatgatgtctgtttctagaaatgagttgttgcagaagttggatccacttgaacaagcaaaagtggatttggtttc
  • Show more
Description: A cloning plasmid for the C1D gene.

C1D cloning plasmid

CSB-CL623834HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 426
  • Sequence: atggcaggtgaagaaattaatgaagactatccagtagaaattcacgagtatttgtcagcgtttgagaattccattggtgctgtggatgagatgctgaagaccatgatgtctgtttctagaaatgagttgttgcagaagttggatccacttgaacaagcaaaagtggatttggtttc
  • Show more
Description: A cloning plasmid for the C1D gene.

pCMV-SPORT6-C1D

PVT13189 2 ug
EUR 391

Anti-C1D (6H2)

YF-MA11287 50 ug
EUR 363
Description: Mouse monoclonal to C1D

Anti-C1D (6H2)

YF-MA17303 200 ul
EUR 363
Description: Mouse monoclonal to C1D

Anti-C1D (4H5)

YF-MA17304 100 ug
EUR 363
Description: Mouse monoclonal to C1D

Chicken Nuclear nucleic acid- binding protein C1D, C1D ELISA KIT

ELI-25339c 96 Tests
EUR 928

C1D ELISA Kit| Bovine Nuclear nucleic acid-binding protein C1D

EF011178 96 Tests
EUR 689

C1D ELISA Kit| chicken Nuclear nucleic acid-binding protein C1D

EF012227 96 Tests
EUR 689

Human Nuclear Nucleic Acid-Binding Protein C1D (C1D) ELISA Kit

20-abx386167
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Mouse Nuclear Nucleic Acid-Binding Protein C1D (C1D) ELISA Kit

abx388728-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Nuclear nucleic acid- binding protein C1D, C1D ELISA KIT

ELI-33295h 96 Tests
EUR 824

Mouse Nuclear nucleic acid- binding protein C1D, C1d ELISA KIT

ELI-34629m 96 Tests
EUR 865

Bovine Nuclear nucleic acid- binding protein C1D, C1D ELISA KIT

ELI-49309b 96 Tests
EUR 928

C1D protein (His tag)

80R-2852 50 ug
EUR 424
Description: Purified recombinant C1D protein (His tag)

C1D Rabbit Polyclonal Antibody

Recent Posts

Categories

January 2022
M T W T F S S
 12
3456789
10111213141516
17181920212223
24252627282930
31  

Pages