FKBP2 Rabbit Polyclonal Antibody

Contact us: [email protected]

FKBP2 Polyclonal Antibody
31443-50ul	SAB	50ul	EUR 187

FKBP2 Polyclonal Antibody
ABP58562-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human FKBP2 protein at amino acid sequence of 80-160 Applications tips:
Description: A polyclonal antibody for detection of FKBP2 from Human, Mouse. This FKBP2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FKBP2 protein at amino acid sequence of 80-160

FKBP2 Polyclonal Antibody
ABP58562-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human FKBP2 protein at amino acid sequence of 80-160 Applications tips:
Description: A polyclonal antibody for detection of FKBP2 from Human, Mouse. This FKBP2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FKBP2 protein at amino acid sequence of 80-160

FKBP2 Polyclonal Antibody
ABP58562-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human FKBP2 protein at amino acid sequence of 80-160 Applications tips:
Description: A polyclonal antibody for detection of FKBP2 from Human, Mouse. This FKBP2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FKBP2 protein at amino acid sequence of 80-160

FKBP2 Polyclonal Antibody
ES11313-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against FKBP2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

FKBP2 Polyclonal Antibody
ES11313-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against FKBP2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

FKBP2 Rabbit pAb
A11845-100ul	Abclonal	100 ul	EUR 308

FKBP2 Rabbit pAb
A11845-200ul	Abclonal	200 ul	EUR 459

FKBP2 Rabbit pAb
A11845-20ul	Abclonal	20 ul	Ask for price

FKBP2 Rabbit pAb
A11845-50ul	Abclonal	50 ul	Ask for price

FKBP2 Rabbit pAb
A8120-100ul	Abclonal	100 ul	EUR 308

FKBP2 Rabbit pAb
A8120-200ul	Abclonal	200 ul	EUR 459

FKBP2 Rabbit pAb
A8120-20ul	Abclonal	20 ul	EUR 183

FKBP2 Rabbit pAb
A8120-50ul	Abclonal	50 ul	EUR 223

FKBP2 Polyclonal Conjugated Antibody
C31443	SAB	100ul	EUR 397

FKBP2 antibody
70R-17310	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal FKBP2 antibody

FKBP2 antibody
70R-5298	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal FKBP2 antibody raised against the N terminal of FKBP2

FKBP2 Antibody
1-CSB-PA008698ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against FKBP2. Recognizes FKBP2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

FKBP2 Antibody
1-CSB-PA008698ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against FKBP2. Recognizes FKBP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:200-1:1000, IHC:1:20-1:200

FKBP2 Antibody
1-CSB-PA008698GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against FKBP2. Recognizes FKBP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

Polyclonal FKBP2 Antibody (N-term)
APR15987G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FKBP2 (N-term). This antibody is tested and proven to work in the following applications:

Human FKBP2 Antibody
32851-05111	AssayPro	150 ug	EUR 261

anti- FKBP2 antibody
FNab03138	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:100 - 1:200 IF: 1:50 - 1:200 Immunogen: FK506 binding protein 2, 13kDa Uniprot ID: P26885 Gene ID: 2286 Research Area: Metabolism
Description: Antibody raised against FKBP2

anti- FKBP2 antibody
FNab03139	FN Test	100µg	EUR 585
Recommended dilution: WB: 1:500-1:1000 IHC: 1:50-1:500 Immunogen: FK506 binding protein 2, 13kDa Uniprot ID: P26885 Gene ID: 2286 Research Area: Metabolism
Description: Antibody raised against FKBP2

Anti-FKBP2 antibody
PAab03138	Lifescience Market	100 ug	EUR 355

Anti-FKBP2 antibody
STJ110419	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a member of the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. This encoded protein is a cis-trans prolyl isomerase that binds the immunosuppressants FK506 and rapamycin. It is thought to function as an ER chaperone and may also act as a component of membrane cytoskeletal scaffolds. Multiple alternatively spliced variants, encoding the same protein, have been identified.

Anti-FKBP2 antibody
STJ113424	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a member of the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. This encoded protein is a cis-trans prolyl isomerase that binds the immunosuppressants FK506 and rapamycin. It is thought to function as an ER chaperone and may also act as a component of membrane cytoskeletal scaffolds. Multiple alternatively spliced variants, encoding the same protein, have been identified.

Anti-FKBP2 antibody
STJ192471	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to FKBP2

FKBP2 protein
30R-1506	Fitzgerald	50 ug	EUR 305
Description: Purified recombinant Human FKBP2 protein

FKBP2 siRNA
20-abx916934	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

FKBP2 siRNA
20-abx916935	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

FK506 Binding Protein 2 (FKBP2) Polyclonal Antibody (Human)
4-PAC479Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FKBP2 (Met1~Leu142) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human FK506 Binding Protein 2 (FKBP2)

FKBP2 Blocking Peptide
33R-8052	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FKBP2 antibody, catalog no. 70R-5298

Human Recombinant FKBP2
6353-50	Biovision		EUR 457

FKBP2 cloning plasmid
CSB-CL008698HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 429 Sequence: atgaggctgagctggttccgggtcctgacagtactgtccatctgcctgagcgccgtggccacggccacgggggccgagggcaaaaggaagctgcagatcggggtcaagaagcgggtggaccactgtcccatcaaatcgcgcaaaggggatgtcctgcacatgcactacacggggaa Show more
Description: A cloning plasmid for the FKBP2 gene.

pCMV-SPORT6-FKBP2
PVT12385	Lifescience Market	2 ug	EUR 391

Human FKBP2 Antibody (Biotin Conjugate)
32851-05121	AssayPro	150 ug	EUR 369

FK506 Binding Protein 2 (FKBP2) Polyclonal Antibody (Human), APC
4-PAC479Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FKBP2 (Met1~Leu142) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human FK506 Binding Protein 2 (FKBP2). This antibody is labeled with APC.

FK506 Binding Protein 2 (FKBP2) Polyclonal Antibody (Human), Biotinylated
4-PAC479Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FKBP2 (Met1~Leu142) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human FK506 Binding Protein 2 (FKBP2). This antibody is labeled with Biotin.

FK506 Binding Protein 2 (FKBP2) Polyclonal Antibody (Human), Cy3
4-PAC479Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FKBP2 (Met1~Leu142) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human FK506 Binding Protein 2 (FKBP2). This antibody is labeled with Cy3.

FK506 Binding Protein 2 (FKBP2) Polyclonal Antibody (Human), FITC
4-PAC479Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FKBP2 (Met1~Leu142) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human FK506 Binding Protein 2 (FKBP2). This antibody is labeled with FITC.

FK506 Binding Protein 2 (FKBP2) Polyclonal Antibody (Human), HRP
4-PAC479Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FKBP2 (Met1~Leu142) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human FK506 Binding Protein 2 (FKBP2). This antibody is labeled with HRP.

FK506 Binding Protein 2 (FKBP2) Polyclonal Antibody (Human), PE
4-PAC479Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FKBP2 (Met1~Leu142) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human FK506 Binding Protein 2 (FKBP2). This antibody is labeled with PE.

Human FKBP2 AssayLite Antibody (FITC Conjugate)
32851-05141	AssayPro	150 ug	EUR 428

Human FKBP2 AssayLite Antibody (RPE Conjugate)
32851-05151	AssayPro	150 ug	EUR 428

Human FKBP2 AssayLite Antibody (APC Conjugate)
32851-05161	AssayPro	150 ug	EUR 428

Human FKBP2 AssayLite Antibody (PerCP Conjugate)
32851-05171	AssayPro	150 ug	EUR 471

FK506 Binding Protein 2 (FKBP2) Antibody
20-abx006068	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

FK506 Binding Protein 2 (FKBP2) Antibody
20-abx112549	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

FK506 Binding Protein 2 (FKBP2) Antibody
abx122884-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

FK506 Binding Protein 2 (FKBP2) Antibody
20-abx126911	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

FK506 Binding Protein 2 (FKBP2) Antibody
20-abx131036	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

FK506 Binding Protein 2 (FKBP2) Antibody
abx032962-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

FK506 Binding Protein 2 (FKBP2) Antibody
abx032962-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

FK506 Binding Protein 2 (FKBP2) Antibody
20-abx320468	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

FK506 Binding Protein 2 (FKBP2) Antibody
abx233138-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

FK506 Binding Protein 2 (FKBP2) Antibody
abx233139-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

FK506 Binding Protein 2 (FKBP2) Antibody
20-abx322674	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

FK506 Binding Protein 2 (FKBP2) Antibody
20-abx225172	Abbexa	EUR 370.00 EUR 606.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Mouse Fkbp2 ELISA KIT
ELI-07779m	Lifescience Market	96 Tests	EUR 865

FKBP2 ELISA KIT|Human
EF009643	Lifescience Market	96 Tests	EUR 689

Mouse FKBP2 shRNA Plasmid
20-abx970350	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human FKBP2 shRNA Plasmid
20-abx951596	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

FKBP2 Rabbit Polyclonal Antibody