Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG

fallback-image

DPP10 Rabbit Polyclonal Antibody

DPP10 Rabbit Polyclonal Antibody

Contact us: [email protected]

DPP10 Polyclonal Antibody

ABP58412-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human DPP10 protein
  • Applications tips:
Description: A polyclonal antibody for detection of DPP10 from Human, Mouse, Rat. This DPP10 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DPP10 protein

DPP10 Polyclonal Antibody

ABP58412-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human DPP10 protein
  • Applications tips:
Description: A polyclonal antibody for detection of DPP10 from Human, Mouse, Rat. This DPP10 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DPP10 protein

DPP10 Polyclonal Antibody

ES11158-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against DPP10 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

DPP10 Polyclonal Antibody

ES11158-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against DPP10 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human Dipeptidyl Peptidase 10 (DPP10) ELISA Kit

DLR-DPP10-Hu-48T 48T
EUR 517
  • Should the Human Dipeptidyl Peptidase 10 (DPP10) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Dipeptidyl Peptidase 10 (DPP10) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Dipeptidyl Peptidase 10 (DPP10) ELISA Kit

DLR-DPP10-Hu-96T 96T
EUR 673
  • Should the Human Dipeptidyl Peptidase 10 (DPP10) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Dipeptidyl Peptidase 10 (DPP10) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Dipeptidyl Peptidase 10 (DPP10) ELISA Kit

RDR-DPP10-Hu-48Tests 48 Tests
EUR 544

Human Dipeptidyl Peptidase 10 (DPP10) ELISA Kit

RDR-DPP10-Hu-96Tests 96 Tests
EUR 756

Human Dipeptidyl Peptidase 10 (DPP10) ELISA Kit

RD-DPP10-Hu-48Tests 48 Tests
EUR 521

Human Dipeptidyl Peptidase 10 (DPP10) ELISA Kit

RD-DPP10-Hu-96Tests 96 Tests
EUR 723

DPP10 Rabbit pAb

A16563-100ul 100 ul
EUR 308

DPP10 Rabbit pAb

A16563-200ul 200 ul
EUR 459

DPP10 Rabbit pAb

A16563-20ul 20 ul
EUR 183

DPP10 Rabbit pAb

A16563-50ul 50 ul
EUR 223

DPP10 Polyclonal Conjugated Antibody

C29884 100ul
EUR 397

Polyclonal DPP10 Antibody (Center)

APR06134G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DPP10 (Center). This antibody is tested and proven to work in the following applications:

DPP10 antibody

20R-DR025 50 ug
EUR 656
Description: Rabbit polyclonal DPP10 antibody

DPP10 antibody

70R-12175 200 ug
EUR 403
Description: Rabbit polyclonal DPP10 antibody

DPP10 Antibody

3898-200
EUR 316

DPP10 Antibody

3898-30T
EUR 146

DPP10 antibody

10R-3873 100 ul
EUR 691
Description: Mouse monoclonal DPP10 antibody

DPP10 antibody

10R-3874 100 ul
EUR 726
Description: Mouse monoclonal DPP10 antibody

DPP10 antibody

70R-6500 50 ug
EUR 467
Description: Rabbit polyclonal DPP10 antibody raised against the middle region of DPP10

Polyclonal Dipeptidylpeptidase 10 / DPP10 Antibody (Internal)

APR02087G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Dipeptidylpeptidase 10 / DPP10 (Internal). This antibody is tested and proven to work in the following applications:

Polyclonal Dipeptidylpeptidase 10 / DPP10 Antibody (Internal)

APG01115G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Dipeptidylpeptidase 10 / DPP10 (Internal). This antibody is tested and proven to work in the following applications:

Anti-DPP10 antibody

STJ119002 100 µl
EUR 277

Anti-DPP10 antibody

STJ192316 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to DPP10

Polyclonal Dipeptidylpeptidase 10 / DPP10 Antibody (Extracellular Domain)

APR02088G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Dipeptidylpeptidase 10 / DPP10 (Extracellular Domain). This antibody is tested and proven to work in the following applications:

Polyclonal Dipeptidylpeptidase 10 / DPP10 Antibody (Extracellular Domain)

APR02089G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Dipeptidylpeptidase 10 / DPP10 (Extracellular Domain). This antibody is tested and proven to work in the following applications:

DPP10 siRNA

20-abx901568
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DPP10 siRNA

20-abx914558
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DPP10 siRNA

20-abx914559
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Rabbit Dipeptidyl Peptidase 10 (DPP10) ELISA Kit

abx363027-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

DPP10 Blocking Peptide

33R-10987 50 ug
EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DPP10 antibody, catalog no. 70R-12175

DPP10 Blocking Peptide

33R-9716 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DPP10 antibody, catalog no. 70R-6500

DPP10 Blocking Peptide

3898BP-50
EUR 153

DPP10 cloning plasmid

CSB-CL839806HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2391
  • Sequence: atgaaccaaactgccagcgtgtcccatcacatcaagtgtcaaccctcaaaaacaatcaaggaactgggaagtaacagccctccacagagaaactggaagggaattgctattgctctgctggtgattttagttgtatgctcactcatcactatgtcagtcatcctcttaaccccag
  • Show more
Description: A cloning plasmid for the DPP10 gene.

Dipeptidyl Peptidase 10 (DPP10) Antibody

20-abx176175
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Dipeptidyl Peptidase 10 (DPP10) Antibody

abx122093-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Dipeptidyl Peptidase 10 (DPP10) Antibody

20-abx172129
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Dipeptidyl Peptidase 10 (DPP10) Antibody

abx034192-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Dipeptidyl Peptidase 10 (DPP10) Antibody

abx034192-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Human DPP10 ELISA Kit

ELA-E0498h 96 Tests
EUR 824

DPP10 ELISA KIT|Human

EF000632 96 Tests
EUR 689

Rat DPP10 shRNA Plasmid

20-abx990572
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse DPP10 shRNA Plasmid

20-abx983015
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human DPP10 shRNA Plasmid

20-abx961592
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DPP10 Recombinant Protein (Human)

RP009763 100 ug Ask for price

DPP10 Recombinant Protein (Rat)

RP198590 100 ug Ask for price

DPP10 Recombinant Protein (Mouse)

RP129932 100 ug Ask for price

Dpp10 ORF Vector (Rat) (pORF)

ORF066198 1.0 ug DNA
EUR 506

DPP10 ORF Vector (Human) (pORF)

ORF003255 1.0 ug DNA
EUR 95

Dpp10 ORF Vector (Mouse) (pORF)

ORF043312 1.0 ug DNA
EUR 506

DPP10 ELISA Kit (Human) (OKCD08935)

OKCD08935 96 Wells
EUR 975
Description: Description of target: This gene encodes a single-pass type II membrane protein that is a member of the S9B family in clan SC of the serine proteases. This protein has no detectable protease activity, most likely due to the absence of the conserved serine residue normally present in the catalytic domain of serine proteases. However, it does bind specific voltage-gated potassium channels and alters their expression and biophysical properties. Mutations in this gene have been associated with asthma. Alternate transcriptional splice variants, encoding different isoforms, have been characterized.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.116ng/mL

DPP10 ELISA Kit (Mouse) (OKEH05815)

OKEH05815 96 Wells
EUR 662
Description: Description of target: Promotes cell surface expression of the potassium channel KCND2.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.169 ng/mL

DPP10 ELISA Kit (Rat) (OKEH06292)

OKEH06292 96 Wells
EUR 662
Description: Description of target: Promotes cell surface expression of the potassium channel KCND2. Modulates the activity and gating characteristics of the potassium channel KCND2.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.235 ng/mL

DPP10 ELISA Kit (Human) (OKEH04330)

OKEH04330 96 Wells
EUR 662
Description: Description of target: This gene encodes a single-pass type II membrane protein that is a member of the S9B family in clan SC of the serine proteases. This protein has no detectable protease activity, most likely due to the absence of the conserved serine residue normally present in the catalytic domain of serine proteases. However, it does bind specific voltage-gated potassium channels and alters their expression and biophysical properties. Mutations in this gene have been associated with asthma. Alternate transcriptional splice variants, encoding different isoforms, have been characterized.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.15 ng/mL

Human Dipeptidyl Peptidase 10 (DPP10) Protein

20-abx653186
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

DPP10 sgRNA CRISPR Lentivector set (Human)

K0628501 3 x 1.0 ug
EUR 339

Dpp10 sgRNA CRISPR Lentivector set (Rat)

K6719101 3 x 1.0 ug
EUR 339

Dpp10 sgRNA CRISPR Lentivector set (Mouse)

K3281301 3 x 1.0 ug
EUR 339

ELISA kit for Human DPP10 (Dipeptidyl Peptidase ?)

E-EL-H0358 1 plate of 96 wells
EUR 534
  • Gentaur's DPP10 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human DPP10. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human DPP10 (Dipeptidyl Peptidase ?) in samples from Serum, Plasma, Cell supernatant

Human Dipeptidyl Peptidase X (DPP10) CLIA Kit

abx195546-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Dipeptidyl Peptidase 10 (DPP10) ELISA Kit

20-abx151344
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Dipeptidyl Peptidase 10 (DPP10) ELISA Kit

abx253879-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Pig Dipeptidyl Peptidase 10 (DPP10) ELISA Kit

abx360964-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Chicken Dipeptidyl Peptidase 10 (DPP10) ELISA Kit

abx355903-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Monkey Dipeptidyl Peptidase 10 (DPP10) ELISA Kit

abx359196-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Dipeptidyl Peptidase 10 (DPP10) ELISA Kit

abx572387-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Dipeptidyl Peptidase 10 (DPP10) CLIA Kit

20-abx495200
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Dipeptidyl Peptidase 10 (DPP10) ELISA Kit

abx513114-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Dipeptidyl Peptidase 10 (DPP10) ELISA Kit

abx513115-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

DPP10 sgRNA CRISPR Lentivector (Human) (Target 1)

K0628502 1.0 ug DNA
EUR 154

DPP10 sgRNA CRISPR Lentivector (Human) (Target 2)

K0628503 1.0 ug DNA
EUR 154

DPP10 sgRNA CRISPR Lentivector (Human) (Target 3)

K0628504 1.0 ug DNA
EUR 154

Dpp10 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6719102 1.0 ug DNA
EUR 154

Dpp10 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6719103 1.0 ug DNA
EUR 154

Dpp10 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6719104 1.0 ug DNA
EUR 154

Dpp10 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3281302 1.0 ug DNA
EUR 154

DPP10 Rabbit Polyclonal Antibody

Recent Posts

Categories

January 2022
M T W T F S S
 12
3456789
10111213141516
17181920212223
24252627282930
31  

Pages