Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG

fallback-image

PHB2 Rabbit Polyclonal Antibody

PHB2 Rabbit Polyclonal Antibody

Contact us: [email protected]

PHB2 Polyclonal Antibody

ABP59895-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PHB2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of PHB2 from Human, Mouse, Rat. This PHB2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PHB2 protein

PHB2 Polyclonal Antibody

ES11135-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PHB2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

PHB2 Polyclonal Antibody

ES11135-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PHB2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

PHB2 Rabbit pAb

A4504-100ul 100 ul
EUR 308

PHB2 Rabbit pAb

A4504-200ul 200 ul
EUR 459

PHB2 Rabbit pAb

A4504-20ul 20 ul
EUR 183

PHB2 Rabbit pAb

A4504-50ul 50 ul
EUR 223

Polyclonal PHB2 Antibody (Y248)

AMM07120G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PHB2 (Y248). This antibody is tested and proven to work in the following applications:

Polyclonal PHB2 Antibody (Y128)

AMM07138G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PHB2 (Y128). This antibody is tested and proven to work in the following applications:

PHB2 Polyclonal Conjugated Antibody

C30576 100ul
EUR 397

PHB2 antibody

70R-19253 50 ul
EUR 435
Description: Rabbit polyclonal PHB2 antibody

PHB2 Antibody

39972-100ul 100ul
EUR 390

PHB2 Antibody

1-CSB-PA859937ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PHB2. Recognizes PHB2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

PHB2 Antibody

1-CSB-PA017886GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PHB2. Recognizes PHB2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

Polyclonal REA (PHB2) Antibody (C-term)

AMM07563G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human REA (PHB2) (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal REA (PHB2) Antibody (N-term)

AMM08674G 0.1ml
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human REA (PHB2) (N-term). This antibody is tested and proven to work in the following applications:

Phb2/ Rat Phb2 ELISA Kit

ELI-35696r 96 Tests
EUR 886

Anti-PHB2 antibody

STJ24978 100 µl
EUR 277

Anti-PHB2 antibody

STJ192293 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PHB2

PHB2 siRNA

20-abx903982
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PHB2 siRNA

20-abx928412
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PHB2 siRNA

20-abx928413
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Polyclonal Prohibitin 2 / PHB2 Antibody (aa88-299)

AMM07340G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Prohibitin 2 / PHB2 (aa88-299). This antibody is tested and proven to work in the following applications:

Polyclonal Prohibitin 2 / PHB2 Antibody (C-Terminus)

AMM07341G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Prohibitin 2 / PHB2 (C-Terminus). This antibody is tested and proven to work in the following applications:

Prohibitin-2 (PHB2) Antibody

20-abx003375
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Prohibitin 2 (PHB2) Antibody

20-abx114703
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Prohibitin-2 (PHB2) Antibody

abx036458-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Prohibitin-2 (PHB2) Antibody

abx033286-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Prohibitin-2 (PHB2) Antibody

abx033286-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Prohibitin-2 (PHB2) Antibody

abx033287-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Prohibitin-2 (PHB2) Antibody

abx033287-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

prohibitin 2 (PHB2) Antibody

abx236801-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Prohibitin-2 (PHB2) Antibody

20-abx321652
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Anti-REA/PHB2 Antibody

PA1951 100ug/vial
EUR 334

PHB2 cloning plasmid

CSB-CL859937HU-10ug 10ug
EUR 362
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 900
  • Sequence: atggcccagaacttgaaggacttggcgggacggctgcccgccgggccccggggcatgggcacggccctgaagctgttgctgggggccggcgccgtggcctacggtgtgcgcgaatctgtgttcaccgtggaaggcgggcacagagccatcttcttcaatcggatcggtggagtgca
  • Show more
Description: A cloning plasmid for the PHB2 gene.

Human Prohibitin-2 (PHB2) Antibody

33127-05111 150 ug
EUR 261

Human Prohibitin-2 (PHB2)

1-CSB-EP859937HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 60.2 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Prohibitin-2(PHB2) expressed in E.coli

PHB2 protein (His tag)

80R-2889 100 ug
EUR 349
Description: Purified recombinant PHB2 protein (His tag)

Prohibitin-2 (PHB2) Protein

20-abx261101
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Rat PHB2 shRNA Plasmid

20-abx987231
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PHB2 shRNA Plasmid

20-abx957758
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse PHB2 shRNA Plasmid

20-abx969323
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pCMV-SPORT6-PHB2 Plasmid

PVT17047 2 ug
EUR 325

PHB2 Recombinant Protein (Human)

RP023278 100 ug Ask for price

PHB2 Recombinant Protein (Mouse)

RP161693 100 ug Ask for price

PHB2 Recombinant Protein (Rat)

RP220277 100 ug Ask for price

Human Prohibitin-2 (PHB2) Antibody (Biotin Conjugate)

33127-05121 150 ug
EUR 369

Phb2 ORF Vector (Rat) (pORF)

ORF073427 1.0 ug DNA
EUR 506

PHB2 ORF Vector (Human) (pORF)

ORF007760 1.0 ug DNA
EUR 95

Phb2 ORF Vector (Mouse) (pORF)

ORF053899 1.0 ug DNA
EUR 506

PHB2 ELISA Kit (Human) (OKEH07846)

OKEH07846 96 Wells
EUR 896
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.08ng/mL

Human Prohibitin-2 (PHB2) AssayLite Antibody (FITC Conjugate)

33127-05141 150 ug
EUR 428

Human Prohibitin-2 (PHB2) AssayLite Antibody (RPE Conjugate)

33127-05151 150 ug
EUR 428

Human Prohibitin-2 (PHB2) AssayLite Antibody (APC Conjugate)

33127-05161 150 ug
EUR 428

Human Prohibitin-2 (PHB2) AssayLite Antibody (PerCP Conjugate)

33127-05171 150 ug
EUR 471

Human PHB2/ Prohibitin-2 ELISA Kit

E1926Hu 1 Kit
EUR 605

PHB2 Rabbit Polyclonal Antibody

Recent Posts

Categories

January 2022
M T W T F S S
 12
3456789
10111213141516
17181920212223
24252627282930
31  

Pages