PHB2 Rabbit Polyclonal Antibody

Contact us: [email protected]

PHB2 Polyclonal Antibody
ABP59895-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human PHB2 protein Applications tips:
Description: A polyclonal antibody for detection of PHB2 from Human, Mouse, Rat. This PHB2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PHB2 protein

PHB2 Polyclonal Antibody
ES11135-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against PHB2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

PHB2 Polyclonal Antibody
ES11135-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against PHB2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

PHB2 Rabbit pAb
A4504-100ul	Abclonal	100 ul	EUR 308

PHB2 Rabbit pAb
A4504-200ul	Abclonal	200 ul	EUR 459

PHB2 Rabbit pAb
A4504-20ul	Abclonal	20 ul	EUR 183

PHB2 Rabbit pAb
A4504-50ul	Abclonal	50 ul	EUR 223

Polyclonal PHB2 Antibody (Y248)
AMM07120G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PHB2 (Y248). This antibody is tested and proven to work in the following applications:

Polyclonal PHB2 Antibody (Y128)
AMM07138G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PHB2 (Y128). This antibody is tested and proven to work in the following applications:

PHB2 Polyclonal Conjugated Antibody
C30576	SAB	100ul	EUR 397

PHB2 antibody
70R-19253	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal PHB2 antibody

PHB2 Antibody
39972-100ul	SAB	100ul	EUR 390

PHB2 Antibody
1-CSB-PA859937ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PHB2. Recognizes PHB2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

PHB2 Antibody
1-CSB-PA017886GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PHB2. Recognizes PHB2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

Polyclonal REA (PHB2) Antibody (C-term)
AMM07563G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human REA (PHB2) (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal REA (PHB2) Antibody (N-term)
AMM08674G	Leading Biology	0.1ml	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human REA (PHB2) (N-term). This antibody is tested and proven to work in the following applications:

Phb2/ Rat Phb2 ELISA Kit
ELI-35696r	Lifescience Market	96 Tests	EUR 886

Anti-PHB2 antibody
STJ24978	St John's Laboratory	100 µl	EUR 277

Anti-PHB2 antibody
STJ192293	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to PHB2

PHB2 siRNA
20-abx903982	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PHB2 siRNA
20-abx928412	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PHB2 siRNA
20-abx928413	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Polyclonal Prohibitin 2 / PHB2 Antibody (aa88-299)
AMM07340G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Prohibitin 2 / PHB2 (aa88-299). This antibody is tested and proven to work in the following applications:

Polyclonal Prohibitin 2 / PHB2 Antibody (C-Terminus)
AMM07341G	Leading Biology	0.05ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Prohibitin 2 / PHB2 (C-Terminus). This antibody is tested and proven to work in the following applications:

Prohibitin-2 (PHB2) Antibody
20-abx003375	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Prohibitin 2 (PHB2) Antibody
20-abx114703	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Prohibitin-2 (PHB2) Antibody
abx036458-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Prohibitin-2 (PHB2) Antibody
abx033286-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Prohibitin-2 (PHB2) Antibody
abx033286-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Prohibitin-2 (PHB2) Antibody
abx033287-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Prohibitin-2 (PHB2) Antibody
abx033287-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

prohibitin 2 (PHB2) Antibody
abx236801-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Prohibitin-2 (PHB2) Antibody
20-abx321652	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Anti-REA/PHB2 Antibody
PA1951	BosterBio	100ug/vial	EUR 334

PHB2 cloning plasmid
CSB-CL859937HU-10ug	Cusabio	10ug	EUR 362
Formulation: 10 μg plasmid + 200μl Glycerol Length: 900 Sequence: atggcccagaacttgaaggacttggcgggacggctgcccgccgggccccggggcatgggcacggccctgaagctgttgctgggggccggcgccgtggcctacggtgtgcgcgaatctgtgttcaccgtggaaggcgggcacagagccatcttcttcaatcggatcggtggagtgca Show more
Description: A cloning plasmid for the PHB2 gene.

Human Prohibitin-2 (PHB2) Antibody
33127-05111	AssayPro	150 ug	EUR 261

Human Prohibitin-2 (PHB2)
1-CSB-EP859937HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 60.2 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Prohibitin-2(PHB2) expressed in E.coli

PHB2 protein (His tag)
80R-2889	Fitzgerald	100 ug	EUR 349
Description: Purified recombinant PHB2 protein (His tag)

Prohibitin-2 (PHB2) Protein
20-abx261101	Abbexa	EUR 3418.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.

Rat PHB2 shRNA Plasmid
20-abx987231	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human PHB2 shRNA Plasmid
20-abx957758	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse PHB2 shRNA Plasmid
20-abx969323	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

pCMV-SPORT6-PHB2 Plasmid
PVT17047	Lifescience Market	2 ug	EUR 325

PHB2 Recombinant Protein (Human)
RP023278	ABM	100 ug	Ask for price

PHB2 Recombinant Protein (Mouse)
RP161693	ABM	100 ug	Ask for price

PHB2 Recombinant Protein (Rat)
RP220277	ABM	100 ug	Ask for price

Human Prohibitin-2 (PHB2) Antibody (Biotin Conjugate)
33127-05121	AssayPro	150 ug	EUR 369

Phb2 ORF Vector (Rat) (pORF)
ORF073427	ABM	1.0 ug DNA	EUR 506

PHB2 ORF Vector (Human) (pORF)
ORF007760	ABM	1.0 ug DNA	EUR 95

Phb2 ORF Vector (Mouse) (pORF)
ORF053899	ABM	1.0 ug DNA	EUR 506

PHB2 ELISA Kit (Human) (OKEH07846)
OKEH07846	Aviva Systems Biology	96 Wells	EUR 896
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.08ng/mL

Human Prohibitin-2 (PHB2) AssayLite Antibody (FITC Conjugate)
33127-05141	AssayPro	150 ug	EUR 428

Human Prohibitin-2 (PHB2) AssayLite Antibody (RPE Conjugate)
33127-05151	AssayPro	150 ug	EUR 428

Human Prohibitin-2 (PHB2) AssayLite Antibody (APC Conjugate)
33127-05161	AssayPro	150 ug	EUR 428

Human Prohibitin-2 (PHB2) AssayLite Antibody (PerCP Conjugate)
33127-05171	AssayPro	150 ug	EUR 471

Human PHB2/ Prohibitin-2 ELISA Kit
E1926Hu	Sunlong	1 Kit	EUR 605

PHB2 Rabbit Polyclonal Antibody