Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG

fallback-image

ECE2 Rabbit Polyclonal Antibody

ECE2 Rabbit Polyclonal Antibody

Contact us: [email protected]

ECE2 Polyclonal Antibody
ABP58450-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human ECE2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of ECE2 from Human, Mouse. This ECE2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ECE2 protein
ECE2 Polyclonal Antibody
ABP58450-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human ECE2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of ECE2 from Human, Mouse. This ECE2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ECE2 protein
ECE2 Polyclonal Antibody
ES11114-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ECE2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
ECE2 Polyclonal Antibody
ES11114-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ECE2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
ECE2 Rabbit pAb
A7049-100ul 100 ul
EUR 308
ECE2 Rabbit pAb
A7049-200ul 200 ul
EUR 459
ECE2 Rabbit pAb
A7049-20ul 20 ul
EUR 183
ECE2 Rabbit pAb
A7049-50ul 50 ul
EUR 223
ECE2 Rabbit pAb
A16636-100ul 100 ul
EUR 308
ECE2 Rabbit pAb
A16636-200ul 200 ul
EUR 459
ECE2 Rabbit pAb
A16636-20ul 20 ul Ask for price
ECE2 Rabbit pAb
A16636-50ul 50 ul Ask for price
Polyclonal ECE2 Antibody (Center)
AMM05862G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ECE2 (Center). This antibody is tested and proven to work in the following applications:
ECE2 Antibody
35719-100ul 100ul
EUR 252
ECE2 Antibody
1-CSB-PA063282
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ECE2. Recognizes ECE2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200
ECE2 Antibody
DF12969 200ul
EUR 304
Description: ECE2 Antibody detects endogenous levels of ECE2.
ECE2 Antibody
1-CSB-PA570366
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ECE2. Recognizes ECE2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:30-1:150
ECE2 Antibody
1-CSB-PA160915
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ECE2. Recognizes ECE2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100
ECE2 antibody
70R-35461 100 ug
EUR 349
Description: Purified Rabbit polyclonal ECE2 antibody
Ece2 antibody
70R-8607 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Ece2 antibody
ECE2 Antibody
1-CSB-PA007372ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against ECE2. Recognizes ECE2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
ECE2 Conjugated Antibody
C35719 100ul
EUR 397
anti- ECE2 antibody
FNab02620 100µg
EUR 505.25
  • Immunogen: endothelin converting enzyme 2
  • Uniprot ID: O60344
  • Gene ID: 9718
  • Research Area: Cardiovascular, Metabolism, Signal Transduction
Description: Antibody raised against ECE2
Anti-ECE2 antibody
PAab02620 100 ug
EUR 355
Anti-ECE2 antibody
STJ119071 100 µl
EUR 277
Anti-ECE2 antibody
STJ29129 100 µl
EUR 277
Description: This gene encodes a member of the M13 family, which includes type 2 integral membrane metallopeptidases. The encoded enzyme is a membrane-bound zinc-dependent metalloprotease. The enzyme catalyzes the cleavage of big endothelin to produce the vasoconstrictor endothelin-1, and plays a role in the processing of several neuroendocrine peptides. It may also have methyltransferase activity. Alternative splicing results in multiple transcript variants.
Anti-ECE2 antibody
STJ192272 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ECE2
ECE2 siRNA
20-abx914903
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
ECE2 siRNA
20-abx914904
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-ECE2
YF-PA16494 50 ug
EUR 363
Description: Mouse polyclonal to ECE2
Ece2 Blocking Peptide
33R-10191 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Ece2 antibody, catalog no. 70R-8607
ECE2 Blocking Peptide
DF12969-BP 1mg
EUR 195
ECE2 cloning plasmid
CSB-CL007372HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 768
  • Sequence: atggcctctccaggggcaggtagggcgcctccggagttaccggagcggaactgcgggtaccgcgaagtcgagtactgggatcagcgctaccaaggcgcagccgattctgccccctacgattggttcggggacttctcctccttccgtgccctcctagagccggagctgcggcccga
  • Show more
Description: A cloning plasmid for the ECE2 gene.
pCMV-SPORT6-ECE2
PVT13547 2 ug
EUR 391
Endothelin Converting Enzyme 2 (ECE2) Antibody
20-abx006421
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

ECE2 Rabbit Polyclonal Antibody

Recent Posts

Categories

January 2022
M T W T F S S
 12
3456789
10111213141516
17181920212223
24252627282930
31  

Pages