Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG

fallback-image

SMC1B Rabbit Polyclonal Antibody

SMC1B Rabbit Polyclonal Antibody

Contact us: [email protected]

SMC1B Polyclonal Antibody
27845-50ul 50ul
EUR 187
SMC1B Polyclonal Antibody
ABP60442-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human SMC1B protein at amino acid sequence of 110-190
  • Applications tips:
Description: A polyclonal antibody for detection of SMC1B from Human. This SMC1B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SMC1B protein at amino acid sequence of 110-190
SMC1B Polyclonal Antibody
ABP60442-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human SMC1B protein at amino acid sequence of 110-190
  • Applications tips:
Description: A polyclonal antibody for detection of SMC1B from Human. This SMC1B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SMC1B protein at amino acid sequence of 110-190
SMC1B Polyclonal Antibody
ABP60442-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human SMC1B protein at amino acid sequence of 110-190
  • Applications tips:
Description: A polyclonal antibody for detection of SMC1B from Human. This SMC1B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SMC1B protein at amino acid sequence of 110-190
SMC1B Polyclonal Antibody
ES11352-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against SMC1B from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
SMC1B Polyclonal Antibody
ES11352-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against SMC1B from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
SMC1B Rabbit pAb
A12905-100ul 100 ul
EUR 308
SMC1B Rabbit pAb
A12905-200ul 200 ul
EUR 459
SMC1B Rabbit pAb
A12905-20ul 20 ul
EUR 183
SMC1B Rabbit pAb
A12905-50ul 50 ul
EUR 223
SMC1B Polyclonal Conjugated Antibody
C27845 100ul
EUR 397
SMC1B antibody
22261-100ul 100ul
EUR 390
SMC1B antibody
70R-13457 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal SMC1B antibody
SMC1B Antibody
1-CSB-PA854104LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SMC1B. Recognizes SMC1B from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500
Anti-SMC1B antibody
STJ114771 100 µl
EUR 277
Anti-SMC1B antibody
STJ192510 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SMC1B
SMC1B siRNA
20-abx934334
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SMC1B siRNA
20-abx934335
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-SMC1B
YF-PA26039 50 ul
EUR 334
Description: Mouse polyclonal to SMC1B
SMC1B Antibody, HRP conjugated
1-CSB-PA854104LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SMC1B. Recognizes SMC1B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
SMC1B Antibody, FITC conjugated
1-CSB-PA854104LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SMC1B. Recognizes SMC1B from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
SMC1B Antibody, Biotin conjugated
1-CSB-PA854104LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SMC1B. Recognizes SMC1B from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
SMC1B cloning plasmid
CSB-CL854104HU-10ug 10ug
EUR 1235
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3486
  • Sequence: atggcccacctggagctgctgcttgtggaaaatttcaagtcgtggcggggccgccaggtcattggccccttccggaggttcacctgcatcatcggccccaacggctctggaaaatctaatgtaatggatgcacttagttttgtaatgggagagaaaatagctaatttaagagtga
  • Show more
Description: A cloning plasmid for the SMC1B gene.
Anti-SMC1B (6A10)
YF-MA18167 100 ug
EUR 363
Description: Mouse monoclonal to SMC1B
Human SMC1B shRNA Plasmid
20-abx958980
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse SMC1B shRNA Plasmid
20-abx980255
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Smc1b ORF Vector (Rat) (pORF)
ORF076690 1.0 ug DNA
EUR 506
SMC1B ORF Vector (Human) (pORF)
ORF014533 1.0 ug DNA
EUR 354
Smc1b ORF Vector (Mouse) (pORF)
ORF057963 1.0 ug DNA
EUR 506
Smc1b sgRNA CRISPR Lentivector set (Rat)
K6148001 3 x 1.0 ug
EUR 339
SMC1B sgRNA CRISPR Lentivector set (Human)
K2199901 3 x 1.0 ug
EUR 339
Smc1b sgRNA CRISPR Lentivector set (Mouse)
K3886601 3 x 1.0 ug
EUR 339
Smc1b sgRNA CRISPR Lentivector (Rat) (Target 1)
K6148002 1.0 ug DNA
EUR 154
Smc1b sgRNA CRISPR Lentivector (Rat) (Target 2)
K6148003 1.0 ug DNA
EUR 154
Smc1b sgRNA CRISPR Lentivector (Rat) (Target 3)
K6148004 1.0 ug DNA
EUR 154
SMC1B sgRNA CRISPR Lentivector (Human) (Target 1)
K2199902 1.0 ug DNA
EUR 154
SMC1B sgRNA CRISPR Lentivector (Human) (Target 2)
K2199903 1.0 ug DNA
EUR 154
SMC1B sgRNA CRISPR Lentivector (Human) (Target 3)
K2199904 1.0 ug DNA
EUR 154
Smc1b sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3886602 1.0 ug DNA
EUR 154
Smc1b sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3886603 1.0 ug DNA
EUR 154
Smc1b sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3886604 1.0 ug DNA
EUR 154
SMC1B Protein Vector (Rat) (pPB-C-His)
PV306758 500 ng
EUR 1191
SMC1B Protein Vector (Rat) (pPB-N-His)
PV306759 500 ng
EUR 1191
SMC1B Protein Vector (Rat) (pPM-C-HA)
PV306760 500 ng
EUR 1191
SMC1B Protein Vector (Rat) (pPM-C-His)
PV306761 500 ng
EUR 1191
SMC1B Protein Vector (Human) (pPB-C-His)
PV058129 500 ng
EUR 481
SMC1B Protein Vector (Human) (pPB-N-His)
PV058130 500 ng
EUR 481
SMC1B Protein Vector (Human) (pPM-C-HA)
PV058131 500 ng
EUR 481
SMC1B Protein Vector (Human) (pPM-C-His)
PV058132 500 ng
EUR 481
SMC1B Protein Vector (Mouse) (pPB-C-His)
PV231850 500 ng
EUR 1065
SMC1B Protein Vector (Mouse) (pPB-N-His)
PV231851 500 ng
EUR 1065
SMC1B Protein Vector (Mouse) (pPM-C-HA)
PV231852 500 ng
EUR 1065
SMC1B Protein Vector (Mouse) (pPM-C-His)
PV231853 500 ng
EUR 1065
Smc1b 3'UTR Luciferase Stable Cell Line
TU119312 1.0 ml Ask for price
Smc1b 3'UTR GFP Stable Cell Line
TU169312 1.0 ml Ask for price
Smc1b 3'UTR Luciferase Stable Cell Line
TU220826 1.0 ml Ask for price
Smc1b 3'UTR GFP Stable Cell Line
TU270826 1.0 ml Ask for price
SMC1B 3'UTR GFP Stable Cell Line
TU073719 1.0 ml
EUR 1394
SMC1B 3'UTR Luciferase Stable Cell Line
TU023719 1.0 ml
EUR 1394
Mouse Structural maintenance of chromosomes protein 1B, Smc1b EL
ELI-42284m 96 Tests
EUR 865
Human Structural maintenance of chromosomes protein 1B, SMC1B EL
ELI-41471h 96 Tests
EUR 824
GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252
GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187
EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252
EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187
Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252
Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187
ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252
ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187
EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252
EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187
mOrange Rabbit Polyclonal Antibody
38079-100ul 100ul
EUR 252
mOrange Rabbit Polyclonal Antibody
38079-50ul 50ul
EUR 187
mStrawberry Rabbit Polyclonal Antibody
38083-100ul 100ul
EUR 252
mStrawberry Rabbit Polyclonal Antibody
38083-50ul 50ul
EUR 187
AmCyan Rabbit Polyclonal Antibody
38086-100ul 100ul
EUR 252
AmCyan Rabbit Polyclonal Antibody
38086-50ul 50ul
EUR 187
EBFP Rabbit Polyclonal Antibody
38087-100ul 100ul
EUR 252
EBFP Rabbit Polyclonal Antibody
38087-50ul 50ul
EUR 187
Vimentin Rabbit Polyclonal Antibody
38104-100ul 100ul
EUR 252
Vimentin Rabbit Polyclonal Antibody
38104-50ul 50ul
EUR 187
LDHD Rabbit Polyclonal Antibody
38105-100ul 100ul
EUR 252
LDHD Rabbit Polyclonal Antibody
38105-50ul 50ul
EUR 187
GAPDH Rabbit Polyclonal Antibody
A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
GAPDH Rabbit Polyclonal Antibody
A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
GAPDH Rabbit Polyclonal Antibody
A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
Rabbit Hemoglobin Polyclonal Antibody
A53073 100 µg
EUR 570.55
Description: The best epigenetics products
Met Rabbit Polyclonal Antibody
ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
VEGF Rabbit Polyclonal Antibody
ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
CD10 Rabbit Polyclonal Antibody
ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
NM23A Rabbit Polyclonal Antibody
ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
NM23A Rabbit Polyclonal Antibody
ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
NM23A Rabbit Polyclonal Antibody
ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

SMC1B Rabbit Polyclonal Antibody

Recent Posts

Categories

January 2022
M T W T F S S
 12
3456789
10111213141516
17181920212223
24252627282930
31  

Pages