WASL Rabbit Polyclonal Antibody

Contact us: [email protected]

WASL Polyclonal Antibody
ES11262-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against WASL from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

WASL Rabbit mAb
A2270-100ul	Abclonal	100 ul	EUR 410

WASL Rabbit mAb
A2270-200ul	Abclonal	200 ul	EUR 571

WASL Rabbit mAb
A2270-20ul	Abclonal	20 ul	EUR 221

WASL Rabbit mAb
A2270-50ul	Abclonal	50 ul	EUR 287

WASL antibody
70R-21295	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal WASL antibody

WASL Antibody
32726-100ul	SAB	100ul	EUR 252

WASL Antibody
49725-100ul	SAB	100ul	EUR 333

WASL Antibody
49725-50ul	SAB	50ul	EUR 239

WASL Antibody
43021-100ul	SAB	100ul	EUR 252

WASL Antibody
1-CSB-PA025973GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against WASL. Recognizes WASL from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

WASL Antibody
ABD7029	Lifescience Market	100 ug	EUR 438

Polyclonal WASL Antibody (N-term)
AMM08505G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human WASL (N-term). This antibody is tested and proven to work in the following applications:

WASL Conjugated Antibody
C49725	SAB	100ul	EUR 397

WASL Conjugated Antibody
C43021	SAB	100ul	EUR 397

WASL Conjugated Antibody
C32726	SAB	100ul	EUR 397

anti- WASL antibody
FNab09470	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:5000 IHC: 1:20-1:200；IF: 1:10-1:100 Immunogen: Wiskott-Aldrich syndrome-like Uniprot ID: O00401 Gene ID: 8976 Research Area: Neuroscience, Metabolism, cancer
Description: Antibody raised against WASL

Anti-WASL antibody
PAab09470	Lifescience Market	100 ug	EUR 386

Anti-WASL antibody
STJ110921	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the Wiskott-Aldrich syndrome (WAS) protein family. Wiskott-Aldrich syndrome proteins share similar domain structure, and associate with a variety of signaling molecules to alter the actin cytoskeleton. The encoded protein is highly expressed in neural tissues, and interacts with several proteins involved in cytoskeletal organization, including cell division control protein 42 (CDC42) and the actin-related protein-2/3 (ARP2/3) complex. The encoded protein may be involved in the formation of long actin microspikes, and in neurite extension.

Anti-WASL antibody
STJ26108	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the Wiskott-Aldrich syndrome (WAS) protein family. Wiskott-Aldrich syndrome proteins share similar domain structure, and associate with a variety of signaling molecules to alter the actin cytoskeleton. The encoded protein is highly expressed in neural tissues, and interacts with several proteins involved in cytoskeletal organization, including cell division control protein 42 (CDC42) and the actin-related protein-2/3 (ARP2/3) complex. The encoded protein may be involved in the formation of long actin microspikes, and in neurite extension.

Anti-WASL antibody
STJ192420	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to WASL

Wasl/ Rat Wasl ELISA Kit
ELI-51494r	Lifescience Market	96 Tests	EUR 886

WASL siRNA
20-abx939642	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

WASL siRNA
20-abx939643	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

WASL recombinant monoclonal antibody
A5400	Bimake	100ul X 3	EUR 595
Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however, Show more
Description: A recombinant monoclonal antibody from rabbit against human WASL for WB,ELISA

Anti-WASL Monoclonal Antibody
M05438	BosterBio	100ug	EUR 397
Description: Rabbit Monoclonal WASL Antibody. Validated in IF, WB and tested in Human, Mouse.

WASL cloning plasmid
CSB-CL025973HU-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1518 Sequence: atgagctccgtccagcagcagccgccgccgccgcggagggtcaccaacgtggggtccctgttgctcaccccgcaggagaacgagtccctcttcactttcctcggcaagaaatgtgtgactatgtcttcagcagtggtgcagttatatgcagcagatcggaactgtatgtggtcaa Show more
Description: A cloning plasmid for the WASL gene.

Wiskott-Aldrich Syndrome-Like (WASL) Antibody
20-abx116678	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

WASL ELISA KIT|Human
EF004250	Lifescience Market	96 Tests	EUR 689

Mouse WASL shRNA Plasmid
20-abx977926	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human WASL shRNA Plasmid
20-abx955926	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

WASL Recombinant Protein (Rat)
RP237164	ABM	100 ug	Ask for price

WASL Recombinant Protein (Human)
RP034510	ABM	100 ug	Ask for price

WASL Recombinant Protein (Mouse)
RP185123	ABM	100 ug	Ask for price

WASL Recombinant Protein (Mouse)
RP185126	ABM	100 ug	Ask for price

Monoclonal WASL Antibody (monoclonal) (M04), Clone: 5F4
AMM08504G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human WASL (monoclonal) (M04). The antibodies are raised in mouse and are from clone 5F4. This antibody is applicable in WB, IHC and IF

Neural Wiskott-Aldrich Syndrome Protein (WASL) Antibody
20-abx127083	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Neural Wiskott-Aldrich Syndrome Protein (WASL) Antibody
abx239470-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Neural Wiskott-Aldrich Syndrome Protein (WASL) Antibody
20-abx002013	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Wasl ORF Vector (Mouse) (pORF)
ORF061709	ABM	1.0 ug DNA	EUR 506

Wasl ORF Vector (Mouse) (pORF)
ORF061710	ABM	1.0 ug DNA	EUR 506

Wasl ORF Vector (Rat) (pORF)
ORF079056	ABM	1.0 ug DNA	EUR 506

WASL ORF Vector (Human) (pORF)
ORF011504	ABM	1.0 ug DNA	EUR 95

Was / Wasl Interacting Protein Family, Member 2 Antibody
20-abx116645	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Wasl sgRNA CRISPR Lentivector set (Rat)
K7509501	ABM	3 x 1.0 ug	EUR 339

WASL sgRNA CRISPR Lentivector set (Human)
K2626001	ABM	3 x 1.0 ug	EUR 339

Wasl sgRNA CRISPR Lentivector set (Mouse)
K4550301	ABM	3 x 1.0 ug	EUR 339

WAS/WASL-Interacting Protein Family Member 2 (WIPF2) Antibody
abx026019-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

WAS/WASL-Interacting Protein Family Member 2 (WIPF2) Antibody
abx026019-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

WAS/WASL Interacting Protein Family Member 1 (WIPF1) Antibody
20-abx015004	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	100 ug 10 ug 200 ug 300 µg
Shipped within 5-10 working days.

WAS/WASL Interacting Protein Family Member 1 (WIPF1) Antibody
20-abx133536	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

WAS/WASL-Interacting Protein Family Member 2 (WIPF2) Antibody
abx239511-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

WAS/WASL Interacting Protein Family Member 1 (WIPF1) Antibody
20-abx329117	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

WAS/WASL Interacting Protein Family Member 1 (WIPF1) Antibody
abx330771-100ul	Abbexa	100 ul	EUR 425
Shipped within 5-10 working days.

WAS/WASL Interacting Protein Family Member 1 (WIPF1) Antibody
abx431652-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Wasl sgRNA CRISPR Lentivector (Rat) (Target 1)
K7509502	ABM	1.0 ug DNA	EUR 154

Wasl sgRNA CRISPR Lentivector (Rat) (Target 2)
K7509503	ABM	1.0 ug DNA	EUR 154

Wasl sgRNA CRISPR Lentivector (Rat) (Target 3)
K7509504	ABM	1.0 ug DNA	EUR 154

WASL sgRNA CRISPR Lentivector (Human) (Target 1)
K2626002	ABM	1.0 ug DNA	EUR 154

WASL sgRNA CRISPR Lentivector (Human) (Target 2)
K2626003	ABM	1.0 ug DNA	EUR 154

WASL sgRNA CRISPR Lentivector (Human) (Target 3)
K2626004	ABM	1.0 ug DNA	EUR 154

Wasl sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4550302	ABM	1.0 ug DNA	EUR 154

Wasl sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4550303	ABM	1.0 ug DNA	EUR 154

Wasl sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4550304	ABM	1.0 ug DNA	EUR 154

Wasl 3'UTR Luciferase Stable Cell Line
TU122188	ABM	1.0 ml	Ask for price

WASL 3'UTR GFP Stable Cell Line
TU078369	ABM	1.0 ml	EUR 1521

Wasl 3'UTR GFP Stable Cell Line
TU172188	ABM	1.0 ml	Ask for price

Wasl 3'UTR Luciferase Stable Cell Line
TU223306	ABM	1.0 ml	Ask for price

WASL 3'UTR Luciferase Stable Cell Line
TU028369	ABM	1.0 ml	EUR 1521

Wasl 3'UTR GFP Stable Cell Line
TU273306	ABM	1.0 ml	Ask for price

WASL Protein Vector (Mouse) (pPB-C-His)
PV246834	ABM	500 ng	EUR 603

WASL Protein Vector (Mouse) (pPB-N-His)
PV246835	ABM	500 ng	EUR 603

WASL Protein Vector (Mouse) (pPM-C-HA)
PV246836	ABM	500 ng	EUR 603

WASL Protein Vector (Mouse) (pPM-C-His)
PV246837	ABM	500 ng	EUR 603

WASL Protein Vector (Mouse) (pPB-C-His)
PV246838	ABM	500 ng	EUR 603

WASL Protein Vector (Mouse) (pPB-N-His)
PV246839	ABM	500 ng	EUR 603

WASL Protein Vector (Mouse) (pPM-C-HA)
PV246840	ABM	500 ng	EUR 603

WASL Protein Vector (Mouse) (pPM-C-His)
PV246841	ABM	500 ng	EUR 603

WASL Protein Vector (Rat) (pPB-C-His)
PV316222	ABM	500 ng	EUR 603

WASL Protein Vector (Rat) (pPB-N-His)
PV316223	ABM	500 ng	EUR 603

WASL Protein Vector (Rat) (pPM-C-HA)
PV316224	ABM	500 ng	EUR 603

WASL Protein Vector (Rat) (pPM-C-His)
PV316225	ABM	500 ng	EUR 603

WASL Protein Vector (Human) (pPB-C-His)
PV046013	ABM	500 ng	EUR 329

WASL Protein Vector (Human) (pPB-N-His)
PV046014	ABM	500 ng	EUR 329

WASL Protein Vector (Human) (pPM-C-HA)
PV046015	ABM	500 ng	EUR 329

WASL Protein Vector (Human) (pPM-C-His)
PV046016	ABM	500 ng	EUR 329

WASL Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV697687	ABM	1.0 ug DNA	EUR 682

WASL Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV697691	ABM	1.0 ug DNA	EUR 682

WASL Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV697692	ABM	1.0 ug DNA	EUR 682

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul	SAB	50ul	EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul	SAB	100ul	EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul	SAB	50ul	EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul	SAB	100ul	EUR 252

WASL Rabbit Polyclonal Antibody