Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG


GNLY Rabbit Polyclonal Antibody

GNLY Rabbit Polyclonal Antibody

Contact us: [email protected]

Human Granulysin (GNLY) ELISA Kit

RD-GNLY-Hu-48Tests 48 Tests
EUR 500

Human Granulysin (GNLY) ELISA Kit

RD-GNLY-Hu-96Tests 96 Tests
EUR 692

GNLY Polyclonal Antibody

ABP58659-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human GNLY protein
  • Applications tips:
Description: A polyclonal antibody for detection of GNLY from Human. This GNLY antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GNLY protein

GNLY Polyclonal Antibody

ABP58659-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human GNLY protein
  • Applications tips:
Description: A polyclonal antibody for detection of GNLY from Human. This GNLY antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GNLY protein

GNLY Polyclonal Antibody

ABP58659-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human GNLY protein
  • Applications tips:
Description: A polyclonal antibody for detection of GNLY from Human. This GNLY antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GNLY protein

GNLY Polyclonal Antibody

ES11035-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against GNLY from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

GNLY Polyclonal Antibody

ES11035-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against GNLY from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

GNLY Antibody

43674-100ul 100ul
EUR 252

Granulysin (GNLY) Antibody

abx027191-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Granulysin (GNLY) Antibody

abx027191-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Granulysin (GNLY) Antibody

  • EUR 1149.00
  • EUR 565.00
  • 1 mg
  • 200 ug
  • Please enquire.

Granulysin (GNLY) Antibody

  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.

GNLY Conjugated Antibody

C43674 100ul
EUR 397

Anti-GNLY antibody

STJ192193 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to GNLY

Rabbit Granulysin (GNLY) ELISA Kit

abx355341-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA17076 50 ug
EUR 363
Description: Mouse polyclonal to GNLY

Granulysin (GNLY) Protein

  • EUR 328.00
  • EUR 5089.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

GNLY cloning plasmid

CSB-CL009627HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 438
  • Sequence: atggctacctgggccctcctgctccttgcagccatgctcctgggcaacccaggtctggtcttctctcgtctgagccctgagtactacgacctggcaagagcccacctgcgtgatgaggagaaatcctgcccgtgcctggcccaggagggcccccagggtgacctgttgaccaaaac
  • Show more
Description: A cloning plasmid for the GNLY gene.

Anti-GNLY (2A6)

YF-MA17387 100 ug
EUR 363
Description: Mouse monoclonal to GNLY

Bovine granulysin,GNLY

QY-E60016 96T
EUR 426


ELA-E1517h 96 Tests
EUR 824


EF000128 96 Tests
EUR 689

Human Granulysin (GNLY) Protein

  • EUR 523.00
  • EUR 244.00
  • EUR 1497.00
  • EUR 606.00
  • EUR 384.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human GNLY shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GNLY Recombinant Protein (Human)

RP013579 100 ug Ask for price

Human granulysin,GNLY ELISA Kit

201-12-0355 96 tests
EUR 440
  • This granulysin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Granulysin (GNLY) CLIA Kit

abx197066-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Granulysin (GNLY) ELISA Kit

  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Granulysin (GNLY) ELISA Kit

abx250848-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human GNLY/ Granulysin ELISA Kit

E1028Hu 1 Kit
EUR 571

Human GNLY(Granulysin) ELISA Kit

EH0156 96T
EUR 524.1
  • Detection range: 0.234-15 ng/ml
  • Uniprot ID: P22749
  • Alias: GNLY(Granulysin)
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.141 ng/ml

Human Granulysin, GNLY ELISA KIT

ELI-05002h 96 Tests
EUR 824

Human granulysin, GNLY ELISA Kit

CSB-E09936h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human granulysin, GNLY in samples from serum, plasma, cell culture supernates, tissue homogenates, urine. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human granulysin, GNLY ELISA Kit

  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human granulysin, GNLY in samples from serum, plasma, cell culture supernates, tissue homogenates, urine. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Chicken Granulysin (GNLY) ELISA Kit

abx354664-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Monkey Granulysin (GNLY) ELISA Kit

abx354943-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Pig Granulysin (GNLY) ELISA Kit

abx355092-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Granulysin (GNLY) ELISA Kit

abx571955-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Granulysin (GNLY) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human granulysin(GNLY)ELISA Kit

GA-E0371HM-48T 48T
EUR 289

Human granulysin(GNLY)ELISA Kit

GA-E0371HM-96T 96T
EUR 466

GNLY ORF Vector (Human) (pORF)

ORF004527 1.0 ug DNA
EUR 95

GNLY ELISA Kit (Human) (OKBB01536)

OKBB01536 96 Wells
EUR 570
Description: Description of target: Granulysin is a substance released by cytotoxic T cells(CD8) when they are attached to infected body cells. The product of this gene is a member of the saposin-like protein(SAPLIP) family. It is mapped to 2p11.2. Granulysin functions to create holes in the target cell membrane and destroy it. It is able to induce apoptosis in target cells and also has antimicrobial action. This gene is expressed in cytolytic granules with perforin, a pore forming protein, and granzymes that are also involved in cytolysis. In addition to it, Granulysin is broadly antimicrobial, killing microbes that cause, for example, tuberculosis and malaria, and can destroy some tumors. A series of peptides generated from the amino acid sequence of Granulysin are potential antibiotics. It has been found that secretory Granulysin is a key molecule responsible for the disseminated keratinocyte death in SJS/TEN.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

GNLY ELISA Kit (Human) (OKCD07459)

OKCD07459 96 Wells
EUR 936
Description: Description of target: The product of this gene is a member of the saposin-like protein (SAPLIP) family and is located in the cytotoxic granules of T cells, which are released upon antigen stimulation. This protein is present in cytotoxic granules of cytotoxic T lymphocytes and natural killer cells, and it has antimicrobial activity against M. tuberculosis and other organisms. Alternatively spliced transcript variants encoding different isoforms have been identified.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.08ng/mL

GNLY ELISA Kit (Human) (OKAN05019)

OKAN05019 96 Wells
EUR 792
Description: Description of target: The product of this gene is a member of the saposin-like protein (SAPLIP) family and is located in the cytotoxic granules of T cells, which are released upon antigen stimulation. This protein is present in cytotoxic granules of cytotoxic T lymphocytes and natural killer cells, and it has antimicrobial activity against M. tuberculosis and other organisms. Alternatively spliced transcript variants encoding different isoforms have been identified.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.08 ng/mL

Human granulysin(GNLY)ELISA Kit

QY-E02489 96T
EUR 361

GNLY Granulysin Human Recombinant Protein

PROTP22749 Regular: 10ug
EUR 317
Description: GNLY Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 159 amino acids and fused to a double His Tag (N+C terminus) and having a total molecular mass of 18.1 kDa.;The GNLY is purified by proprietary chromatographic techniques.

Human Granulysin ELISA Kit (GNLY)

RK01482 96 Tests
EUR 521

Human Granulysin (GNLY) ELISA Kit

SEB517Hu-10x96wellstestplate 10x96-wells test plate
EUR 4502.43
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granulysin (GNLY) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granulysin (GNLY) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Granulysin (GNLY) ELISA Kit

SEB517Hu-1x48wellstestplate 1x48-wells test plate
EUR 458.44
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granulysin (GNLY) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granulysin (GNLY) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Granulysin (GNLY) ELISA Kit

SEB517Hu-1x96wellstestplate 1x96-wells test plate
EUR 612.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granulysin (GNLY) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granulysin (GNLY) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Granulysin (GNLY) ELISA Kit

SEB517Hu-5x96wellstestplate 5x96-wells test plate
EUR 2454.23
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granulysin (GNLY) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granulysin (GNLY) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Granulysin (GNLY) ELISA Kit

  • EUR 4553.00
  • EUR 2405.00
  • EUR 613.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Granulysin elisa. Alternative names of the recognized antigen: NKG5
  • LAG-2
  • TLA519
  • T-Lymphocyte Activation Gene 519
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Granulysin (GNLY) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Bovine granulysin,GNLY ELISA Kit

QY-E60039 96T
EUR 426

CLIA kit for Human GNLY (Granulysin)

E-CL-H1038 1 plate of 96 wells
EUR 584
  • Gentaur's GNLY CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human GNLY . Standards or samples are added to the micro CLIA plate wells and combined with the
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human GNLY (Granulysin) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human GNLY (Granulysin)

E-EL-H1618 1 plate of 96 wells
EUR 534
  • Gentaur's GNLY ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human GNLY. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human GNLY (Granulysin) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human GNLY (Granulysin)

ELK2059 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Granulysin (GNLY). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Granulysin (GNLY
  • Show more
Description: A sandwich ELISA kit for detection of Granulysin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

GNLY sgRNA CRISPR Lentivector set (Human)

K0878801 3 x 1.0 ug
EUR 339

GNLY sgRNA CRISPR Lentivector (Human) (Target 1)

K0878802 1.0 ug DNA
EUR 154

GNLY sgRNA CRISPR Lentivector (Human) (Target 2)

K0878803 1.0 ug DNA
EUR 154

GNLY sgRNA CRISPR Lentivector (Human) (Target 3)

K0878804 1.0 ug DNA
EUR 154

GNLY ELISA Kit (Human) : 96 Wells (OKEH02758)

OKEH02758 96 Wells
EUR 662
Description: Description of target: The product of this gene is a member of the saposin-like protein (SAPLIP) family and is located in the cytotoxic granules of T cells, which are released upon antigen stimulation. This protein is present in cytotoxic granules of cytotoxic T lymphocytes and natural killer cells, and it has antimicrobial activity against M. tuberculosis and other organisms. Alternatively spliced transcript variants encoding different isoforms have been identified.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.156 ng/mL

GNLY 3'UTR Luciferase Stable Cell Line

TU009013 1.0 ml
EUR 1394

GNLY 3'UTR GFP Stable Cell Line

TU059013 1.0 ml
EUR 1394

GNLY Protein Vector (Human) (pPB-C-His)

PV018105 500 ng
EUR 329

GNLY Protein Vector (Human) (pPB-N-His)

PV018106 500 ng
EUR 329

GNLY Protein Vector (Human) (pPM-C-HA)

PV018107 500 ng
EUR 329

GNLY Protein Vector (Human) (pPM-C-His)

PV018108 500 ng
EUR 329

Recombinant Human GNLY Protein, His, E.coli-10ug

QP12021-10ug 10ug
EUR 201

Recombinant Human GNLY Protein, His, E.coli-1mg

QP12021-1mg 1mg
EUR 4153

Recombinant Human GNLY Protein, His, E.coli-2ug

QP12021-2ug 2ug
EUR 155

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GNLY Rabbit Polyclonal Antibody

Recent Posts


January 2022
