Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG

fallback-image

RAP1B Rabbit Polyclonal Antibody

RAP1B Rabbit Polyclonal Antibody

Contact us: [email protected]

RAP1B Polyclonal Antibody
ABP60090-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human RAP1B protein at amino acid sequence of 110-190
  • Applications tips:
Description: A polyclonal antibody for detection of RAP1B from Human, Mouse, Rat. This RAP1B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAP1B protein at amino acid sequence of 110-190
RAP1B Polyclonal Antibody
ABP60090-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human RAP1B protein at amino acid sequence of 110-190
  • Applications tips:
Description: A polyclonal antibody for detection of RAP1B from Human, Mouse, Rat. This RAP1B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAP1B protein at amino acid sequence of 110-190
RAP1B Polyclonal Antibody
ABP60090-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human RAP1B protein at amino acid sequence of 110-190
  • Applications tips:
Description: A polyclonal antibody for detection of RAP1B from Human, Mouse, Rat. This RAP1B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAP1B protein at amino acid sequence of 110-190
RAP1B Polyclonal Antibody
ES11183-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against RAP1B from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
RAP1B Polyclonal Antibody
ES11183-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against RAP1B from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
RAP1B Rabbit pAb
A12925-100ul 100 ul
EUR 308
RAP1B Rabbit pAb
A12925-200ul 200 ul
EUR 459
RAP1B Rabbit pAb
A12925-20ul 20 ul
EUR 183
RAP1B Rabbit pAb
A12925-50ul 50 ul
EUR 223
RAP1B Rabbit pAb
A2665-100ul 100 ul
EUR 308
RAP1B Rabbit pAb
A2665-200ul 200 ul
EUR 459
RAP1B Rabbit pAb
A2665-20ul 20 ul
EUR 183
RAP1B Rabbit pAb
A2665-50ul 50 ul
EUR 223
RAP1B Antibody
31033-100ul 100ul
EUR 252
RAP1B Antibody
31033-50ul 50ul
EUR 187
RAP1B antibody
70R-19769 50 ul
EUR 435
Description: Rabbit polyclonal RAP1B antibody
RAP1B antibody
70R-2677 50 ug
EUR 467
Description: Rabbit polyclonal RAP1B antibody raised against the N terminal of RAP1B
RAP1B Antibody
1-CSB-PA834666
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RAP1B. Recognizes RAP1B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:200-1:1000, IHC:1:50-1:200
RAP1B Antibody
1-CSB-PA841145
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RAP1B. Recognizes RAP1B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200
RAP1B Antibody
DF12309 200ul
EUR 304
Description: RAP1B antibody detects endogenous levels of RAP1B.
RAP1B Antibody
1-CSB-PA03269A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAP1B. Recognizes RAP1B from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200
RAP1B Antibody
1-CSB-PA019323GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against RAP1B. Recognizes RAP1B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
RAP1B Polyclonal Antibody, Biotin Conjugated
A60523 100 µg
EUR 570.55
Description: reagents widely cited
RAP1B Polyclonal Antibody, FITC Conjugated
A60524 100 µg
EUR 570.55
Description: Ask the seller for details
RAP1B Polyclonal Antibody, HRP Conjugated
A60525 100 µg
EUR 570.55
Description: The best epigenetics products
RAS-Related Protein RAP1B (RAP1B) Antibody
20-abx006177
  • EUR 411.00
  • EUR 592.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
RAS-Related Protein RAP1B (RAP1B) Antibody
20-abx214692
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
RAS-Related Protein RAP1B (RAP1B) Antibody
abx122290-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
RAS-Related Protein RAP1B (RAP1B) Antibody
abx028359-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
RAS-Related Protein RAP1B (RAP1B) Antibody
abx028359-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
RAS-Related Protein RAP1B (RAP1B) Antibody
20-abx242180
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
RAS-Related Protein RAP1B (RAP1B) Antibody
20-abx318369
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
RAS-Related Protein RAP1B (RAP1B) Antibody (HRP)
20-abx306308
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
RAS-Related Protein RAP1B (RAP1B) Antibody (FITC)
20-abx306309
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
RAS-Related Protein RAP1B (RAP1B) Antibody (Biotin)
20-abx306310
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
RAP1B Conjugated Antibody
C31033 100ul
EUR 397
RAP1B-Specific Antibody
abx237109-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
anti- RAP1B antibody
FNab07109 100µg
EUR 548.75
  • Immunogen: RAP1B, member of RAS oncogene family
  • Uniprot ID: P61224
  • Research Area: Signal Transduction
Description: Antibody raised against RAP1B
Anti-RAP1B antibody
STJ25297 100 µl
EUR 277
Description: This gene encodes a member of the RAS-like small GTP-binding protein superfamily. Members of this family regulate multiple cellular processes including cell adhesion and growth and differentiation. This protein localizes to cellular membranes and has been shown to regulate integrin-mediated cell signaling. This protein also plays a role in regulating outside-in signaling in platelets. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 3, 5, 6 and 9.
Anti-RAP1B antibody
STJ114791 100 µl
EUR 277
Description: This gene encodes a member of the RAS-like small GTP-binding protein superfamily. Members of this family regulate multiple cellular processes including cell adhesion and growth and differentiation. This protein localizes to cellular membranes and has been shown to regulate integrin-mediated cell signaling. This protein also plays a role in regulating outside-in signaling in platelets. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 3, 5, 6 and 9.
Anti-RAP1B antibody
STJ192341 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RAP1B
Rap1b/ Rat Rap1b ELISA Kit
ELI-36035r 96 Tests
EUR 886
RAP1B siRNA
20-abx904463
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RAP1B siRNA
20-abx930870
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RAP1B siRNA
20-abx930871
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RAP1B Antibody, HRP conjugated
1-CSB-PA03269B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAP1B. Recognizes RAP1B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
RAP1B Antibody, FITC conjugated
1-CSB-PA03269C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAP1B. Recognizes RAP1B from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
RAP1B Antibody, Biotin conjugated
1-CSB-PA03269D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAP1B. Recognizes RAP1B from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Anti-RAP1B-Specific antibody
PAab07109 100 ug
EUR 386
Human RAS-Related Protein RAP1B (RAP1B) ELISA Kit
abx382683-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
RAP1B Blocking Peptide
33R-6359 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RAP1B antibody, catalog no. 70R-2677
RAP1B Blocking Peptide
DF12309-BP 1mg
EUR 195
RAP1B cloning plasmid
CSB-CL019323HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 555
  • Sequence: atgcgtgagtataagctagtcgttcttggctcaggaggcgttggaaagtctgctttgactgtacaatttgttcaaggaatttttgtagaaaaatacgatcctacgatagaagattcttatagaaagcaagttgaagtagatgcacaacagtgtatgcttgaaatcttggatactgc
  • Show more
Description: A cloning plasmid for the RAP1B gene.
pCMV-SPORT6-RAP1B
PVT12568 2 ug
EUR 391
RAP1B protein (His tag)
80R-1649 50 ug
EUR 397
Description: Purified recombinant Human RAP1B protein
RAP1B ELISA KIT|Human
EF002312 96 Tests
EUR 689
Rat RAP1B shRNA Plasmid
20-abx987735
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human RAP1B shRNA Plasmid
20-abx953994
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse RAP1B shRNA Plasmid
20-abx980933
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
RAP1B Recombinant Protein (Human)
RP025747 100 ug Ask for price
RAP1B Recombinant Protein (Mouse)
RP166742 100 ug Ask for price
RAP1B Recombinant Protein (Rat)
RP223589 100 ug Ask for price
Rabbit Ras related protein Rap 1b(RAP1B) ELISA kit
E04R0393-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Ras related protein Rap 1b(RAP1B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Ras related protein Rap 1b(RAP1B) ELISA kit
E04R0393-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Ras related protein Rap 1b(RAP1B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Ras related protein Rap 1b(RAP1B) ELISA kit
E04R0393-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Ras related protein Rap 1b(RAP1B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rap1B, Member Of Ras Oncogene Family Antibody
20-abx115042
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Rap1b ORF Vector (Rat) (pORF)
ORF074531 1.0 ug DNA
EUR 506
RAP1B ORF Vector (Human) (pORF)
ORF008583 1.0 ug DNA
EUR 95
Rap1b ORF Vector (Mouse) (pORF)
ORF055582 1.0 ug DNA
EUR 506
RAP1B ELISA Kit (Human) (OKCA01482)
OKCA01482 96 Wells
EUR 846
Description: Description of target: GTP-binding protein that possesses intrinsic GTPase activity. Contributes to the polarizing activity of KRIT1 and CDH5 in the establishment and maintenance of correct endothelial cell polarity and vascular lumen. Required for the localization of phosphorylated PRKCZ, PARD3 and TIAM1 to the cell junction. Plays a role in the establishment of basal endothelial barrier function.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 5.86 pg/mL
RAP1B ELISA Kit (Human) (OKEH08547)
OKEH08547 96 Wells
EUR 896
Description: Description of target: This gene encodes a member of the RAS-like small GTP-binding protein superfamily. Members of this family regulate multiple cellular processes including cell adhesion and growth and differentiation. This protein localizes to cellular membranes and has been shown to regulate integrin-mediated cell signaling. This protein also plays a role in regulating outside-in signaling in platelets. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 3, 5, 6 and 9.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.4ng/mL
RAP1B, Member RAS Oncogene Family Protein
20-abx262469
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.
Rap1b sgRNA CRISPR Lentivector set (Mouse)
K4992101 3 x 1.0 ug
EUR 339
Rap1b sgRNA CRISPR Lentivector set (Rat)
K7078201 3 x 1.0 ug
EUR 339
RAP1B sgRNA CRISPR Lentivector set (Human)
K1784901 3 x 1.0 ug
EUR 339
Recombinant Human RAP1B, Member RAS Oncogene Family
7-06061 2µg Ask for price
Recombinant Human RAP1B, Member RAS Oncogene Family
7-06062 10µg Ask for price
Recombinant Human RAP1B, Member RAS Oncogene Family
7-06063 1mg Ask for price
Rap1b sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4992102 1.0 ug DNA
EUR 154
Rap1b sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4992103 1.0 ug DNA
EUR 154
Rap1b sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4992104 1.0 ug DNA
EUR 154
Rap1b sgRNA CRISPR Lentivector (Rat) (Target 1)
K7078202 1.0 ug DNA
EUR 154
Rap1b sgRNA CRISPR Lentivector (Rat) (Target 2)
K7078203 1.0 ug DNA
EUR 154
Rap1b sgRNA CRISPR Lentivector (Rat) (Target 3)
K7078204 1.0 ug DNA
EUR 154
RAP1B sgRNA CRISPR Lentivector (Human) (Target 1)
K1784902 1.0 ug DNA
EUR 154
RAP1B sgRNA CRISPR Lentivector (Human) (Target 2)
K1784903 1.0 ug DNA
EUR 154
RAP1B sgRNA CRISPR Lentivector (Human) (Target 3)
K1784904 1.0 ug DNA
EUR 154
RAP1B Protein Vector (Rat) (pPB-C-His)
PV298122 500 ng
EUR 603
RAP1B Protein Vector (Rat) (pPB-N-His)
PV298123 500 ng
EUR 603
RAP1B Protein Vector (Rat) (pPM-C-HA)
PV298124 500 ng
EUR 603
RAP1B Protein Vector (Rat) (pPM-C-His)
PV298125 500 ng
EUR 603
RAP1B Protein Vector (Human) (pPB-C-His)
PV034329 500 ng
EUR 329
RAP1B Protein Vector (Human) (pPB-N-His)
PV034330 500 ng
EUR 329
RAP1B Protein Vector (Human) (pPM-C-HA)
PV034331 500 ng
EUR 329
RAP1B Protein Vector (Human) (pPM-C-His)
PV034332 500 ng
EUR 329
RAP1B Protein Vector (Mouse) (pPB-C-His)
PV222326 500 ng
EUR 603
RAP1B Protein Vector (Mouse) (pPB-N-His)
PV222327 500 ng
EUR 603
RAP1B Protein Vector (Mouse) (pPM-C-HA)
PV222328 500 ng
EUR 603
RAP1B Protein Vector (Mouse) (pPM-C-His)
PV222329 500 ng
EUR 603

RAP1B Rabbit Polyclonal Antibody

Recent Posts

Categories

January 2022
M T W T F S S
 12
3456789
10111213141516
17181920212223
24252627282930
31  

Pages