RAP1B Rabbit Polyclonal Antibody

Contact us: [email protected]

RAP1B Polyclonal Antibody
ABP60090-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human RAP1B protein at amino acid sequence of 110-190 Applications tips:
Description: A polyclonal antibody for detection of RAP1B from Human, Mouse, Rat. This RAP1B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAP1B protein at amino acid sequence of 110-190

RAP1B Polyclonal Antibody
ABP60090-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human RAP1B protein at amino acid sequence of 110-190 Applications tips:
Description: A polyclonal antibody for detection of RAP1B from Human, Mouse, Rat. This RAP1B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAP1B protein at amino acid sequence of 110-190

RAP1B Polyclonal Antibody
ABP60090-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human RAP1B protein at amino acid sequence of 110-190 Applications tips:
Description: A polyclonal antibody for detection of RAP1B from Human, Mouse, Rat. This RAP1B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAP1B protein at amino acid sequence of 110-190

RAP1B Polyclonal Antibody
ES11183-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against RAP1B from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

RAP1B Polyclonal Antibody
ES11183-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against RAP1B from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

RAP1B Rabbit pAb
A12925-100ul	Abclonal	100 ul	EUR 308

RAP1B Rabbit pAb
A12925-200ul	Abclonal	200 ul	EUR 459

RAP1B Rabbit pAb
A12925-20ul	Abclonal	20 ul	EUR 183

RAP1B Rabbit pAb
A12925-50ul	Abclonal	50 ul	EUR 223

RAP1B Rabbit pAb
A2665-100ul	Abclonal	100 ul	EUR 308

RAP1B Rabbit pAb
A2665-200ul	Abclonal	200 ul	EUR 459

RAP1B Rabbit pAb
A2665-20ul	Abclonal	20 ul	EUR 183

RAP1B Rabbit pAb
A2665-50ul	Abclonal	50 ul	EUR 223

RAP1B Antibody
31033-100ul	SAB	100ul	EUR 252

RAP1B Antibody
31033-50ul	SAB	50ul	EUR 187

RAP1B antibody
70R-19769	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal RAP1B antibody

RAP1B antibody
70R-2677	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal RAP1B antibody raised against the N terminal of RAP1B

RAP1B Antibody
1-CSB-PA834666	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RAP1B. Recognizes RAP1B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:200-1:1000, IHC:1:50-1:200

RAP1B Antibody
1-CSB-PA841145	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RAP1B. Recognizes RAP1B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

RAP1B Antibody
DF12309	Affbiotech	200ul	EUR 304
Description: RAP1B antibody detects endogenous levels of RAP1B.

RAP1B Antibody
1-CSB-PA03269A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAP1B. Recognizes RAP1B from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

RAP1B Antibody
1-CSB-PA019323GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against RAP1B. Recognizes RAP1B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

RAP1B Polyclonal Antibody, Biotin Conjugated
A60523	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

RAP1B Polyclonal Antibody, FITC Conjugated
A60524	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

RAP1B Polyclonal Antibody, HRP Conjugated
A60525	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

RAS-Related Protein RAP1B (RAP1B) Antibody
20-abx006177	Abbexa	EUR 411.00 EUR 592.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

RAS-Related Protein RAP1B (RAP1B) Antibody
20-abx214692	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

RAS-Related Protein RAP1B (RAP1B) Antibody
abx122290-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

RAS-Related Protein RAP1B (RAP1B) Antibody
abx028359-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

RAS-Related Protein RAP1B (RAP1B) Antibody
abx028359-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

RAS-Related Protein RAP1B (RAP1B) Antibody
20-abx242180	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

RAS-Related Protein RAP1B (RAP1B) Antibody
20-abx318369	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

RAS-Related Protein RAP1B (RAP1B) Antibody (HRP)
20-abx306308	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

RAS-Related Protein RAP1B (RAP1B) Antibody (FITC)
20-abx306309	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

RAS-Related Protein RAP1B (RAP1B) Antibody (Biotin)
20-abx306310	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

RAP1B Conjugated Antibody
C31033	SAB	100ul	EUR 397

RAP1B-Specific Antibody
abx237109-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

anti- RAP1B antibody
FNab07109	FN Test	100µg	EUR 548.75
Immunogen: RAP1B, member of RAS oncogene family Uniprot ID: P61224 Research Area: Signal Transduction
Description: Antibody raised against RAP1B

Anti-RAP1B antibody
STJ25297	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the RAS-like small GTP-binding protein superfamily. Members of this family regulate multiple cellular processes including cell adhesion and growth and differentiation. This protein localizes to cellular membranes and has been shown to regulate integrin-mediated cell signaling. This protein also plays a role in regulating outside-in signaling in platelets. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 3, 5, 6 and 9.

Anti-RAP1B antibody
STJ114791	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the RAS-like small GTP-binding protein superfamily. Members of this family regulate multiple cellular processes including cell adhesion and growth and differentiation. This protein localizes to cellular membranes and has been shown to regulate integrin-mediated cell signaling. This protein also plays a role in regulating outside-in signaling in platelets. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 3, 5, 6 and 9.

Anti-RAP1B antibody
STJ192341	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to RAP1B

Rap1b/ Rat Rap1b ELISA Kit
ELI-36035r	Lifescience Market	96 Tests	EUR 886

RAP1B siRNA
20-abx904463	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RAP1B siRNA
20-abx930870	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RAP1B siRNA
20-abx930871	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RAP1B Antibody, HRP conjugated
1-CSB-PA03269B0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAP1B. Recognizes RAP1B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RAP1B Antibody, FITC conjugated
1-CSB-PA03269C0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAP1B. Recognizes RAP1B from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RAP1B Antibody, Biotin conjugated
1-CSB-PA03269D0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAP1B. Recognizes RAP1B from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-RAP1B-Specific antibody
PAab07109	Lifescience Market	100 ug	EUR 386

Human RAS-Related Protein RAP1B (RAP1B) ELISA Kit
abx382683-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

RAP1B Blocking Peptide
33R-6359	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RAP1B antibody, catalog no. 70R-2677

RAP1B Blocking Peptide
DF12309-BP	Affbiotech	1mg	EUR 195

RAP1B cloning plasmid
CSB-CL019323HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 555 Sequence: atgcgtgagtataagctagtcgttcttggctcaggaggcgttggaaagtctgctttgactgtacaatttgttcaaggaatttttgtagaaaaatacgatcctacgatagaagattcttatagaaagcaagttgaagtagatgcacaacagtgtatgcttgaaatcttggatactgc Show more
Description: A cloning plasmid for the RAP1B gene.

pCMV-SPORT6-RAP1B
PVT12568	Lifescience Market	2 ug	EUR 391

RAP1B protein (His tag)
80R-1649	Fitzgerald	50 ug	EUR 397
Description: Purified recombinant Human RAP1B protein

RAP1B ELISA KIT|Human
EF002312	Lifescience Market	96 Tests	EUR 689

Rat RAP1B shRNA Plasmid
20-abx987735	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human RAP1B shRNA Plasmid
20-abx953994	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse RAP1B shRNA Plasmid
20-abx980933	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

RAP1B Recombinant Protein (Human)
RP025747	ABM	100 ug	Ask for price

RAP1B Recombinant Protein (Mouse)
RP166742	ABM	100 ug	Ask for price

RAP1B Recombinant Protein (Rat)
RP223589	ABM	100 ug	Ask for price

Rabbit Ras related protein Rap 1b(RAP1B) ELISA kit
E04R0393-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Ras related protein Rap 1b(RAP1B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Ras related protein Rap 1b(RAP1B) ELISA kit
E04R0393-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Ras related protein Rap 1b(RAP1B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Ras related protein Rap 1b(RAP1B) ELISA kit
E04R0393-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Ras related protein Rap 1b(RAP1B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rap1B, Member Of Ras Oncogene Family Antibody
20-abx115042	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Rap1b ORF Vector (Rat) (pORF)
ORF074531	ABM	1.0 ug DNA	EUR 506

RAP1B ORF Vector (Human) (pORF)
ORF008583	ABM	1.0 ug DNA	EUR 95

Rap1b ORF Vector (Mouse) (pORF)
ORF055582	ABM	1.0 ug DNA	EUR 506

RAP1B ELISA Kit (Human) (OKCA01482)
OKCA01482	Aviva Systems Biology	96 Wells	EUR 846
Description: Description of target: GTP-binding protein that possesses intrinsic GTPase activity. Contributes to the polarizing activity of KRIT1 and CDH5 in the establishment and maintenance of correct endothelial cell polarity and vascular lumen. Required for the localization of phosphorylated PRKCZ, PARD3 and TIAM1 to the cell junction. Plays a role in the establishment of basal endothelial barrier function.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 5.86 pg/mL

RAP1B ELISA Kit (Human) (OKEH08547)
OKEH08547	Aviva Systems Biology	96 Wells	EUR 896
Description: Description of target: This gene encodes a member of the RAS-like small GTP-binding protein superfamily. Members of this family regulate multiple cellular processes including cell adhesion and growth and differentiation. This protein localizes to cellular membranes and has been shown to regulate integrin-mediated cell signaling. This protein also plays a role in regulating outside-in signaling in platelets. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 3, 5, 6 and 9.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.4ng/mL

RAP1B, Member RAS Oncogene Family Protein
20-abx262469	Abbexa	EUR 328.00 EUR 6397.00 EUR 230.00	10 ug 1 mg 2 µg
Shipped within 5-10 working days.

Rap1b sgRNA CRISPR Lentivector set (Mouse)
K4992101	ABM	3 x 1.0 ug	EUR 339

Rap1b sgRNA CRISPR Lentivector set (Rat)
K7078201	ABM	3 x 1.0 ug	EUR 339

RAP1B sgRNA CRISPR Lentivector set (Human)
K1784901	ABM	3 x 1.0 ug	EUR 339

Recombinant Human RAP1B, Member RAS Oncogene Family
7-06061	CHI Scientific	2µg	Ask for price

Recombinant Human RAP1B, Member RAS Oncogene Family
7-06062	CHI Scientific	10µg	Ask for price

Recombinant Human RAP1B, Member RAS Oncogene Family
7-06063	CHI Scientific	1mg	Ask for price

Rap1b sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4992102	ABM	1.0 ug DNA	EUR 154

Rap1b sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4992103	ABM	1.0 ug DNA	EUR 154

Rap1b sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4992104	ABM	1.0 ug DNA	EUR 154

Rap1b sgRNA CRISPR Lentivector (Rat) (Target 1)
K7078202	ABM	1.0 ug DNA	EUR 154

Rap1b sgRNA CRISPR Lentivector (Rat) (Target 2)
K7078203	ABM	1.0 ug DNA	EUR 154

Rap1b sgRNA CRISPR Lentivector (Rat) (Target 3)
K7078204	ABM	1.0 ug DNA	EUR 154

RAP1B sgRNA CRISPR Lentivector (Human) (Target 1)
K1784902	ABM	1.0 ug DNA	EUR 154

RAP1B sgRNA CRISPR Lentivector (Human) (Target 2)
K1784903	ABM	1.0 ug DNA	EUR 154

RAP1B sgRNA CRISPR Lentivector (Human) (Target 3)
K1784904	ABM	1.0 ug DNA	EUR 154

RAP1B Protein Vector (Rat) (pPB-C-His)
PV298122	ABM	500 ng	EUR 603

RAP1B Protein Vector (Rat) (pPB-N-His)
PV298123	ABM	500 ng	EUR 603

RAP1B Protein Vector (Rat) (pPM-C-HA)
PV298124	ABM	500 ng	EUR 603

RAP1B Protein Vector (Rat) (pPM-C-His)
PV298125	ABM	500 ng	EUR 603

RAP1B Protein Vector (Human) (pPB-C-His)
PV034329	ABM	500 ng	EUR 329

RAP1B Protein Vector (Human) (pPB-N-His)
PV034330	ABM	500 ng	EUR 329

RAP1B Protein Vector (Human) (pPM-C-HA)
PV034331	ABM	500 ng	EUR 329

RAP1B Protein Vector (Human) (pPM-C-His)
PV034332	ABM	500 ng	EUR 329

RAP1B Protein Vector (Mouse) (pPB-C-His)
PV222326	ABM	500 ng	EUR 603

RAP1B Protein Vector (Mouse) (pPB-N-His)
PV222327	ABM	500 ng	EUR 603

RAP1B Protein Vector (Mouse) (pPM-C-HA)
PV222328	ABM	500 ng	EUR 603

RAP1B Protein Vector (Mouse) (pPM-C-His)
PV222329	ABM	500 ng	EUR 603

RAP1B Rabbit Polyclonal Antibody