Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG


LGMN Rabbit Polyclonal Antibody

LGMN Rabbit Polyclonal Antibody

Contact us: [email protected]

Mouse Legumain (LGMN) ELISA Kit

EUR 527
  • Should the Mouse Legumain (LGMN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Legumain (LGMN) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Legumain (LGMN) ELISA Kit

EUR 688
  • Should the Mouse Legumain (LGMN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Legumain (LGMN) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Legumain (LGMN) ELISA Kit

RDR-LGMN-Hu-48Tests 48 Tests
EUR 544

Human Legumain (LGMN) ELISA Kit

RDR-LGMN-Hu-96Tests 96 Tests
EUR 756

Mouse Legumain (LGMN) ELISA Kit

RDR-LGMN-Mu-48Tests 48 Tests
EUR 557

Mouse Legumain (LGMN) ELISA Kit

RDR-LGMN-Mu-96Tests 96 Tests
EUR 774

Human Legumain (LGMN) ELISA Kit

RD-LGMN-Hu-48Tests 48 Tests
EUR 521

Human Legumain (LGMN) ELISA Kit

RD-LGMN-Hu-96Tests 96 Tests
EUR 723

Mouse Legumain (LGMN) ELISA Kit

RD-LGMN-Mu-48Tests 48 Tests
EUR 533

Mouse Legumain (LGMN) ELISA Kit

RD-LGMN-Mu-96Tests 96 Tests
EUR 740

LGMN Polyclonal Antibody

27479-100ul 100ul
EUR 252

LGMN Polyclonal Antibody

27479-50ul 50ul
EUR 187

LGMN Polyclonal Antibody

A69571 100 ?g
EUR 628.55
Description: The best epigenetics products

LGMN Polyclonal Antibody

ABP59112-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human LGMN protein at amino acid sequence of 60-140
  • Applications tips:
Description: A polyclonal antibody for detection of LGMN from Human, Mouse, Rat. This LGMN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LGMN protein at amino acid sequence of 60-140

LGMN Polyclonal Antibody

ABP59112-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human LGMN protein at amino acid sequence of 60-140
  • Applications tips:
Description: A polyclonal antibody for detection of LGMN from Human, Mouse, Rat. This LGMN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LGMN protein at amino acid sequence of 60-140

LGMN Polyclonal Antibody

ABP59112-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human LGMN protein at amino acid sequence of 60-140
  • Applications tips:
Description: A polyclonal antibody for detection of LGMN from Human, Mouse, Rat. This LGMN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LGMN protein at amino acid sequence of 60-140

LGMN Polyclonal Antibody

ES11326-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against LGMN from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

LGMN Polyclonal Antibody

ES11326-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against LGMN from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

LGMN Rabbit pAb

A10570-100ul 100 ul
EUR 308

LGMN Rabbit pAb

A10570-200ul 200 ul
EUR 459

LGMN Rabbit pAb

A10570-20ul 20 ul
EUR 183

LGMN Rabbit pAb

A10570-50ul 50 ul
EUR 223

LGMN Polyclonal Conjugated Antibody

C27479 100ul
EUR 397

LGMN Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LGMN. Recognizes LGMN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:500-1:1000

Polyclonal LGMN Antibody (N-term)

APR08220G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LGMN (N-term). This antibody is tested and proven to work in the following applications:

Polyclonal LGMN Antibody - middle region

APR08221G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LGMN - middle region. This antibody is tested and proven to work in the following applications:

LGMN Polyclonal Antibody, HRP Conjugated

A69572 100 ?g
EUR 628.55
Description: kits suitable for this type of research

LGMN Polyclonal Antibody, FITC Conjugated

A69573 100 ?g
EUR 628.55
Description: fast delivery possible

LGMN Polyclonal Antibody, Biotin Conjugated

A69574 100 ?g
EUR 628.55
Description: reagents widely cited

Legumain (LGMN) Polyclonal Antibody (Mouse)

  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LGMN (Val18~Tyr435)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Legumain (LGMN)

Legumain (LGMN) Polyclonal Antibody (Mouse), APC

  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LGMN (Val18~Tyr435)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Legumain (LGMN). This antibody is labeled with APC.

Legumain (LGMN) Polyclonal Antibody (Mouse), Biotinylated

  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LGMN (Val18~Tyr435)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Legumain (LGMN). This antibody is labeled with Biotin.

Legumain (LGMN) Polyclonal Antibody (Mouse), Cy3

  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LGMN (Val18~Tyr435)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Legumain (LGMN). This antibody is labeled with Cy3.

Legumain (LGMN) Polyclonal Antibody (Mouse), FITC

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LGMN (Val18~Tyr435)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Legumain (LGMN). This antibody is labeled with FITC.

Legumain (LGMN) Polyclonal Antibody (Mouse), HRP

  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LGMN (Val18~Tyr435)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Legumain (LGMN). This antibody is labeled with HRP.

Legumain (LGMN) Polyclonal Antibody (Mouse), PE

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LGMN (Val18~Tyr435)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Legumain (LGMN). This antibody is labeled with PE.

Legumain (LGMN) Antibody

  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Legumain (LGMN) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Legumain (LGMN) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Legumain (LGMN) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Legumain (LGMN) Antibody

abx145639-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Legumain (LGMN) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Legumain (LGMN) Antibody

abx031307-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Legumain (LGMN) Antibody

abx031307-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Legumain (LGMN) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-LGMN antibody

STJ112585 100 µl
EUR 277
Description: This gene encodes a cysteine protease that has a strict specificity for hydrolysis of asparaginyl bonds. This enzyme may be involved in the processing of bacterial peptides and endogenous proteins for MHC class II presentation in the lysosomal/endosomal systems. Enzyme activation is triggered by acidic pH and appears to be autocatalytic. Protein expression occurs after monocytes differentiate into dendritic cells. A fully mature, active enzyme is produced following lipopolysaccharide expression in mature dendritic cells. Overexpression of this gene may be associated with the majority of solid tumor types. This gene has a pseudogene on chromosome 13. Several alternatively spliced transcript variants have been described, but the biological validity of only two has been determined. These two variants encode the same isoform.

Anti-LGMN Antibody

STJ501591 100 µg
EUR 476

Anti-LGMN antibody

STJ192484 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to LGMN

Lgmn/ Rat Lgmn ELISA Kit

ELI-03979r 96 Tests
EUR 886

Legumain (LGMN) Polyclonal Antibody (Human, Mouse, Rat)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LGMN (Val18~Tyr433)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Legumain (LGMN)

Legumain (LGMN) Polyclonal Antibody (Mouse), APC-Cy7

  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LGMN (Val18~Tyr435)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Legumain (LGMN). This antibody is labeled with APC-Cy7.

LGMN protein

80R-4392 50 ug
EUR 349
Description: Purified Recombinant LGMN protein


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LGMN Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LGMN. Recognizes LGMN from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

LGMN Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LGMN. Recognizes LGMN from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

LGMN Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LGMN. Recognizes LGMN from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Legumain (LGMN) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Legumain (LGMN) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Legumain (LGMN) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-LGMN Antibody (Biotin)

STJ501592 100 µg
EUR 586

Anti-LGMN Antibody (FITC)

STJ501593 100 µg
EUR 586

Legumain (LGMN) Polyclonal Antibody (Human, Mouse, Rat), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LGMN (Val18~Tyr433)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Legumain (LGMN). This antibody is labeled with APC.

Legumain (LGMN) Polyclonal Antibody (Human, Mouse, Rat), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LGMN (Val18~Tyr433)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Legumain (LGMN). This antibody is labeled with Biotin.

Legumain (LGMN) Polyclonal Antibody (Human, Mouse, Rat), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LGMN (Val18~Tyr433)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Legumain (LGMN). This antibody is labeled with Cy3.

Legumain (LGMN) Polyclonal Antibody (Human, Mouse, Rat), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LGMN (Val18~Tyr433)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Legumain (LGMN). This antibody is labeled with FITC.

Legumain (LGMN) Polyclonal Antibody (Human, Mouse, Rat), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LGMN (Val18~Tyr433)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Legumain (LGMN). This antibody is labeled with HRP.

Legumain (LGMN) Polyclonal Antibody (Human, Mouse, Rat), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LGMN (Val18~Tyr433)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Legumain (LGMN). This antibody is labeled with PE.

Human Legumain (LGMN)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 38.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Legumain(LGMN) expressed in E.coli

Mouse Legumain (Lgmn)

  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 38.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Legumain(Lgmn) expressed in E.coli

Human Legumain (LGMN)

  • EUR 504.00
  • EUR 265.00
  • EUR 1832.00
  • EUR 763.00
  • EUR 1216.00
  • EUR 334.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 36.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Legumain(LGMN) expressed in Yeast

Mouse Legumain (Lgmn)

  • EUR 586.00
  • EUR 299.00
  • EUR 2172.00
  • EUR 900.00
  • EUR 1442.00
  • EUR 382.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 36.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Legumain(Lgmn) expressed in Yeast

LGMN cloning plasmid

CSB-CL012903HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1302
  • Sequence: atggtttggaaagtagctgtattcctcagtgtggccctgggcattggtgccattcctatagatgatcctgaagatggaggcaagcactgggtggtgatcgtggcaggttcaaatggctggtataattataggcaccaggcagacgcgtgccatgcctaccagatcattcaccgca
  • Show more
Description: A cloning plasmid for the LGMN gene.

Recombinant Legumain (LGMN)

  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q99538
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 51.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Legumain expressed in: E.coli

Recombinant Legumain (LGMN)

  • EUR 485.28
  • EUR 233.00
  • EUR 1544.80
  • EUR 581.60
  • EUR 1063.20
  • EUR 388.00
  • EUR 3712.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O89017
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 51.3KDa
  • Isoelectric Point: 5.9
Description: Recombinant Mouse Legumain expressed in: E.coli

LGMN Rabbit Polyclonal Antibody

Recent Posts


January 2022
