LUM Rabbit Polyclonal Antibody

Contact us: [email protected]

Human Lumican (LUM) ELISA Kit
RDR-LUM-Hu-48Tests	Reddot Biotech	48 Tests	EUR 522

Human Lumican (LUM) ELISA Kit
RDR-LUM-Hu-96Tests	Reddot Biotech	96 Tests	EUR 724

Human Lumican (LUM) ELISA Kit
RD-LUM-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Lumican (LUM) ELISA Kit
RD-LUM-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

LUM Polyclonal Antibody
ABP59166-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human LUM protein at amino acid sequence of 30-110 Applications tips:
Description: A polyclonal antibody for detection of LUM from Human, Mouse, Rat. This LUM antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LUM protein at amino acid sequence of 30-110

LUM Polyclonal Antibody
ABP59166-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human LUM protein at amino acid sequence of 30-110 Applications tips:
Description: A polyclonal antibody for detection of LUM from Human, Mouse, Rat. This LUM antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LUM protein at amino acid sequence of 30-110

LUM Polyclonal Antibody
ABP59166-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human LUM protein at amino acid sequence of 30-110 Applications tips:
Description: A polyclonal antibody for detection of LUM from Human, Mouse, Rat. This LUM antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LUM protein at amino acid sequence of 30-110

LUM Polyclonal Antibody
ES11180-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against LUM from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

LUM Polyclonal Antibody
ES11180-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against LUM from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

LUM Rabbit pAb
A5352-100ul	Abclonal	100 ul	EUR 308

LUM Rabbit pAb
A5352-200ul	Abclonal	200 ul	EUR 459

LUM Rabbit pAb
A5352-20ul	Abclonal	20 ul	EUR 183

LUM Rabbit pAb
A5352-50ul	Abclonal	50 ul	EUR 223

Polyclonal LUM Antibody (Center)
APR05952G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LUM (Center). This antibody is tested and proven to work in the following applications:

Polyclonal LUM Antibody (N-term)
APR05951G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LUM (N-term). This antibody is tested and proven to work in the following applications:

Lumican (LUM) Polyclonal Antibody (Human)
4-PAB496Hu01	Cloud-Clone	EUR 239.00 EUR 2391.00 EUR 598.00 EUR 299.00 EUR 211.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LUM (Gln19~Asn338) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Lumican (LUM)

Lumican (LUM) Polyclonal Antibody (Mouse)
4-PAB496Mu01	Cloud-Clone	EUR 243.00 EUR 2457.00 EUR 613.00 EUR 305.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LUM (Gln19~Asn338) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Lumican (LUM)

LUM antibody
70R-18332	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal LUM antibody

LUM Antibody
36591-100ul	SAB	100ul	EUR 252

LUM Antibody
1-CSB-PA781691	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against LUM. Recognizes LUM from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:50-1:200

LUM Antibody
1-CSB-PA788951	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against LUM. Recognizes LUM from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

LUM Antibody
DF7293	Affbiotech	200ul	EUR 304
Description: LUM Antibody detects endogenous levels of total LUM.

LUM antibody
70R-9283	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal LUM antibody

LUM Antibody
1-CSB-PA013234ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against LUM. Recognizes LUM from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

LUM Antibody
1-CSB-PA013234GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against LUM. Recognizes LUM from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Lum Antibody
1-CSB-PA013234LA01RA	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Lum. Recognizes Lum from Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

LUM Antibody
ABD7293	Lifescience Market	100 ug	EUR 438

Polyclonal Lum antibody - N-terminal region
APR01254G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Lum - N-terminal region. This antibody is tested and proven to work in the following applications:

Lumican (LUM) Polyclonal Antibody (Human), APC
4-PAB496Hu01-APC	Cloud-Clone	EUR 333.00 EUR 3113.00 EUR 872.00 EUR 423.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LUM (Gln19~Asn338) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Lumican (LUM). This antibody is labeled with APC.

Lumican (LUM) Polyclonal Antibody (Human), Biotinylated
4-PAB496Hu01-Biotin	Cloud-Clone	EUR 303.00 EUR 2341.00 EUR 697.00 EUR 369.00 EUR 216.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LUM (Gln19~Asn338) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Lumican (LUM). This antibody is labeled with Biotin.

Lumican (LUM) Polyclonal Antibody (Human), Cy3
4-PAB496Hu01-Cy3	Cloud-Clone	EUR 403.00 EUR 4109.00 EUR 1121.00 EUR 523.00 EUR 245.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LUM (Gln19~Asn338) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Lumican (LUM). This antibody is labeled with Cy3.

Lumican (LUM) Polyclonal Antibody (Human), FITC
4-PAB496Hu01-FITC	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LUM (Gln19~Asn338) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Lumican (LUM). This antibody is labeled with FITC.

Lumican (LUM) Polyclonal Antibody (Human), HRP
4-PAB496Hu01-HRP	Cloud-Clone	EUR 305.00 EUR 2714.00 EUR 772.00 EUR 383.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LUM (Gln19~Asn338) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Lumican (LUM). This antibody is labeled with HRP.

Lumican (LUM) Polyclonal Antibody (Human), PE
4-PAB496Hu01-PE	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LUM (Gln19~Asn338) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Lumican (LUM). This antibody is labeled with PE.

Lumican (LUM) Polyclonal Antibody (Mouse), APC
4-PAB496Mu01-APC	Cloud-Clone	EUR 340.00 EUR 3203.00 EUR 894.00 EUR 432.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LUM (Gln19~Asn338) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Lumican (LUM). This antibody is labeled with APC.

Lumican (LUM) Polyclonal Antibody (Mouse), Biotinylated
4-PAB496Mu01-Biotin	Cloud-Clone	EUR 307.00 EUR 2407.00 EUR 714.00 EUR 375.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LUM (Gln19~Asn338) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Lumican (LUM). This antibody is labeled with Biotin.

Lumican (LUM) Polyclonal Antibody (Mouse), Cy3
4-PAB496Mu01-Cy3	Cloud-Clone	EUR 411.00 EUR 4229.00 EUR 1151.00 EUR 535.00 EUR 248.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LUM (Gln19~Asn338) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Lumican (LUM). This antibody is labeled with Cy3.

Lumican (LUM) Polyclonal Antibody (Mouse), FITC
4-PAB496Mu01-FITC	Cloud-Clone	EUR 292.00 EUR 2582.00 EUR 735.00 EUR 366.00 EUR 194.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LUM (Gln19~Asn338) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Lumican (LUM). This antibody is labeled with FITC.

Lumican (LUM) Polyclonal Antibody (Mouse), HRP
4-PAB496Mu01-HRP	Cloud-Clone	EUR 311.00 EUR 2792.00 EUR 791.00 EUR 391.00 EUR 205.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LUM (Gln19~Asn338) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Lumican (LUM). This antibody is labeled with HRP.

Lumican (LUM) Polyclonal Antibody (Mouse), PE
4-PAB496Mu01-PE	Cloud-Clone	EUR 292.00 EUR 2582.00 EUR 735.00 EUR 366.00 EUR 194.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LUM (Gln19~Asn338) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Lumican (LUM). This antibody is labeled with PE.

Rabbit Lumican, LUM ELISA KIT
ELI-04936Ra	Lifescience Market	96 Tests	EUR 928

Rabbit Lumican (LUM) ELISA Kit
abx355262-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Lumican (LUM) Antibody
20-abx213779	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Lumican (LUM) Antibody
20-abx214200	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Lumican (LUM) Antibody
20-abx100111	Abbexa	EUR 411.00 EUR 133.00 EUR 1149.00 EUR 565.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Lumican (LUM) Antibody
20-abx100112	Abbexa	EUR 425.00 EUR 133.00 EUR 1177.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Lumican (LUM) Antibody
20-abx113541	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Lumican (LUM) Antibody
20-abx131975	Abbexa	EUR 328.00 EUR 815.00 EUR 425.00 EUR 154.00 EUR 258.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-7 working days.

Lumican (LUM) Antibody
abx033510-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Lumican (LUM) Antibody
abx033510-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Lumican (LUM) Antibody
abx033511-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Lumican (LUM) Antibody
abx033511-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

LUM Conjugated Antibody
C36591	SAB	100ul	EUR 397

Lumican (Lum) Antibody
20-abx319736	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Lumican (LUM) Antibody
20-abx320659	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Lumican (LUM) Antibody
abx234890-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Lumican (LUM) Antibody
20-abx225270	Abbexa	EUR 370.00 EUR 606.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Anti-LUM antibody
STJ27305	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the small leucine-rich proteoglycan (SLRP) family that includes decorin, biglycan, fibromodulin, keratocan, epiphycan, and osteoglycin. In these bifunctional molecules, the protein moiety binds collagen fibrils and the highly charged hydrophilic glycosaminoglycans regulate interfibrillar spacings. Lumican is the major keratan sulfate proteoglycan of the cornea but is also distributed in interstitial collagenous matrices throughout the body. Lumican may regulate collagen fibril organization and circumferential growth, corneal transparency, and epithelial cell migration and tissue repair.

Anti-LUM antibody
STJ192338	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to LUM

Lum/ Rat Lum ELISA Kit
ELI-04935r	Lifescience Market	96 Tests	EUR 886

Lumican (LUM) Polyclonal Antibody (Human), APC-Cy7
4-PAB496Hu01-APC-Cy7	Cloud-Clone	EUR 547.00 EUR 6106.00 EUR 1624.00 EUR 727.00 EUR 310.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LUM (Gln19~Asn338) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Lumican (LUM). This antibody is labeled with APC-Cy7.

Lumican (LUM) Polyclonal Antibody (Mouse), APC-Cy7
4-PAB496Mu01-APC-Cy7	Cloud-Clone	EUR 560.00 EUR 6286.00 EUR 1669.00 EUR 745.00 EUR 315.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LUM (Gln19~Asn338) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Lumican (LUM). This antibody is labeled with APC-Cy7.

Lum Antibody, HRP conjugated
1-CSB-PA013234LB01RA	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Lum. Recognizes Lum from Rat. This antibody is HRP conjugated. Tested in the following application: ELISA

Lum Antibody, FITC conjugated
1-CSB-PA013234LC01RA	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Lum. Recognizes Lum from Rat. This antibody is FITC conjugated. Tested in the following application: ELISA

Lum Antibody, Biotin conjugated
1-CSB-PA013234LD01RA	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Lum. Recognizes Lum from Rat. This antibody is Biotin conjugated. Tested in the following application: ELISA

Lumican (LUM) Antibody (Biotin)
20-abx272147	Abbexa	EUR 439.00 EUR 244.00 EUR 1261.00 EUR 606.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Lumican (LUM) Antibody (Biotin)
20-abx272934	Abbexa	EUR 467.00 EUR 244.00 EUR 1344.00 EUR 634.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Lumican (Lum) Antibody (HRP)
20-abx319737	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Lumican (Lum) Antibody (FITC)
20-abx319738	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Lumican (Lum) Antibody (Biotin)
20-abx319739	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Lumican (LUM) Antibody (FITC)
20-abx274286	Abbexa	EUR 495.00 EUR 258.00 EUR 1469.00 EUR 690.00 EUR 398.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

LUM Blocking Peptide
33R-1163	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of C9orf96 antibody, catalog no. 70R-1210

Rat Lumican (Lum)
1-CSB-EP013234RA	Cusabio	EUR 505.00 EUR 265.00 EUR 1827.00 EUR 766.00 EUR 1218.00 EUR 335.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 40.5 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Lumican(Lum) expressed in E.coli

Rat Lumican (Lum)
1-CSB-MP013234RA	Cusabio	EUR 293.00 EUR 963.00 EUR 409.00 EUR 717.00	100ug 1MG 200ug 500ug
MW: 40.5 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Lumican(Lum) expressed in Mammalian cell

LUM Blocking Peptide
DF7293-BP	Affbiotech	1mg	EUR 195

LUM cloning plasmid
CSB-CL013234HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1017 Sequence: atgagtctaagtgcatttactctcttcctggcattgattggtggtaccagtggccagtactatgattatgattttcccctatcaatttatgggcaatcatcaccaaactgtgcaccagaatgtaactgccctgaaagctacccaagtgccatgtactgtgatgagctgaaattga Show more
Description: A cloning plasmid for the LUM gene.

LUM cloning plasmid
CSB-CL013234HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1017 Sequence: atgagtctaagtgcatttactctcttcctggcattgattggtggtaccagtggccagtactatgattatgattttcccctatcaatttatgggcaatcatcaccaaactgtgcaccagaatgtaactgccctgaaagctacccaagtgccatgtactgtgatgagctgaaattga Show more
Description: A cloning plasmid for the LUM gene.

Recombinant Lumican (LUM)
4-RPB496Hu01	Cloud-Clone	EUR 368.80 EUR 202.00 EUR 1108.00 EUR 436.00 EUR 772.00 EUR 310.00 EUR 2620.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P51884 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 38.1kDa Isoelectric Point: 6.3
Description: Recombinant Human Lumican expressed in: E.coli

Recombinant Lumican (LUM)
4-RPB496Mu01	Cloud-Clone	EUR 470.94 EUR 229.00 EUR 1491.04 EUR 563.68 EUR 1027.36 EUR 378.00 EUR 3577.60	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P51885 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 37.8kDa Isoelectric Point: 6.2
Description: Recombinant Mouse Lumican expressed in: E.coli

Lumican (LUM) Monoclonal Antibody (Human)
4-MAB496Hu22	Cloud-Clone	EUR 247.00 EUR 2523.00 EUR 628.00 EUR 311.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Gln19~Asn338 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Lumican (LUM)

Lumican (LUM) Monoclonal Antibody (Human), APC
4-MAB496Hu22-APC	Cloud-Clone	EUR 346.00 EUR 3293.00 EUR 917.00 EUR 441.00 EUR 220.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Gln19~Asn338 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Lumican (LUM). This antibody is labeled with APC.

Lumican (LUM) Monoclonal Antibody (Human), Biotinylated
4-MAB496Hu22-Biotin	Cloud-Clone	EUR 312.00 EUR 2473.00 EUR 730.00 EUR 382.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Gln19~Asn338 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Lumican (LUM). This antibody is labeled with Biotin.

Lumican (LUM) Monoclonal Antibody (Human), Cy3
4-MAB496Hu22-Cy3	Cloud-Clone	EUR 420.00 EUR 4349.00 EUR 1181.00 EUR 547.00 EUR 252.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Gln19~Asn338 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Lumican (LUM). This antibody is labeled with Cy3.

Lumican (LUM) Monoclonal Antibody (Human), FITC
4-MAB496Hu22-FITC	Cloud-Clone	EUR 297.00 EUR 2654.00 EUR 753.00 EUR 373.00 EUR 196.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Gln19~Asn338 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Lumican (LUM). This antibody is labeled with FITC.

Lumican (LUM) Monoclonal Antibody (Human), HRP
4-MAB496Hu22-HRP	Cloud-Clone	EUR 316.00 EUR 2870.00 EUR 811.00 EUR 399.00 EUR 207.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Gln19~Asn338 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Lumican (LUM). This antibody is labeled with HRP.

Lumican (LUM) Monoclonal Antibody (Human), PE
4-MAB496Hu22-PE	Cloud-Clone	EUR 297.00 EUR 2654.00 EUR 753.00 EUR 373.00 EUR 196.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Gln19~Asn338 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Lumican (LUM). This antibody is labeled with PE.

LUM protein (His tag)
80R-3624	Fitzgerald	100 ug	EUR 327
Description: Purified recombinant LUM protein (His tag)

Human Lumican (LUM) Protein
20-abx067831	Abbexa	EUR 523.00 EUR 244.00 EUR 1497.00 EUR 606.00 EUR 384.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Mouse Lumican (LUM) Protein
20-abx067832	Abbexa	EUR 662.00 EUR 272.00 EUR 2012.00 EUR 787.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human LUM ELISA Kit
ELA-E1496h	Lifescience Market	96 Tests	EUR 824

LUM ELISA KIT|Human
EF000178	Lifescience Market	96 Tests	EUR 689

Rat LUM shRNA Plasmid
20-abx986652	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human LUM shRNA Plasmid
20-abx952749	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse LUM shRNA Plasmid
20-abx971372	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

LUM Recombinant Protein (Human)
RP018424	ABM	100 ug	Ask for price

LUM Recombinant Protein (Human)
RP018427	ABM	100 ug	Ask for price

LUM Recombinant Protein (Mouse)
RP148628	ABM	100 ug	Ask for price

LUM Recombinant Protein (Rat)
RP210287	ABM	100 ug	Ask for price

LUM Rabbit Polyclonal Antibody