Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG


LUM Rabbit Polyclonal Antibody

LUM Rabbit Polyclonal Antibody

Contact us: [email protected]

Human Lumican (LUM) ELISA Kit

RDR-LUM-Hu-48Tests 48 Tests
EUR 522

Human Lumican (LUM) ELISA Kit

RDR-LUM-Hu-96Tests 96 Tests
EUR 724

Human Lumican (LUM) ELISA Kit

RD-LUM-Hu-48Tests 48 Tests
EUR 500

Human Lumican (LUM) ELISA Kit

RD-LUM-Hu-96Tests 96 Tests
EUR 692

LUM Polyclonal Antibody

ABP59166-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human LUM protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of LUM from Human, Mouse, Rat. This LUM antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LUM protein at amino acid sequence of 30-110

LUM Polyclonal Antibody

ABP59166-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human LUM protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of LUM from Human, Mouse, Rat. This LUM antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LUM protein at amino acid sequence of 30-110

LUM Polyclonal Antibody

ABP59166-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human LUM protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of LUM from Human, Mouse, Rat. This LUM antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LUM protein at amino acid sequence of 30-110

LUM Polyclonal Antibody

ES11180-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against LUM from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

LUM Polyclonal Antibody

ES11180-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against LUM from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

LUM Rabbit pAb

A5352-100ul 100 ul
EUR 308

LUM Rabbit pAb

A5352-200ul 200 ul
EUR 459

LUM Rabbit pAb

A5352-20ul 20 ul
EUR 183

LUM Rabbit pAb

A5352-50ul 50 ul
EUR 223

Polyclonal LUM Antibody (Center)

APR05952G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LUM (Center). This antibody is tested and proven to work in the following applications:

Polyclonal LUM Antibody (N-term)

APR05951G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LUM (N-term). This antibody is tested and proven to work in the following applications:

Lumican (LUM) Polyclonal Antibody (Human)

  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LUM (Gln19~Asn338)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Lumican (LUM)

Lumican (LUM) Polyclonal Antibody (Mouse)

  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LUM (Gln19~Asn338)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Lumican (LUM)

LUM antibody

70R-18332 50 ul
EUR 435
Description: Rabbit polyclonal LUM antibody

LUM Antibody

36591-100ul 100ul
EUR 252

LUM Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against LUM. Recognizes LUM from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:50-1:200

LUM Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against LUM. Recognizes LUM from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

LUM Antibody

DF7293 200ul
EUR 304
Description: LUM Antibody detects endogenous levels of total LUM.

LUM antibody

70R-9283 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal LUM antibody

LUM Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against LUM. Recognizes LUM from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

LUM Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against LUM. Recognizes LUM from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Lum Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Lum. Recognizes Lum from Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

LUM Antibody

ABD7293 100 ug
EUR 438

Polyclonal Lum antibody - N-terminal region

APR01254G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Lum - N-terminal region. This antibody is tested and proven to work in the following applications:

Lumican (LUM) Polyclonal Antibody (Human), APC

  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LUM (Gln19~Asn338)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Lumican (LUM). This antibody is labeled with APC.

Lumican (LUM) Polyclonal Antibody (Human), Biotinylated

  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LUM (Gln19~Asn338)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Lumican (LUM). This antibody is labeled with Biotin.

Lumican (LUM) Polyclonal Antibody (Human), Cy3

  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LUM (Gln19~Asn338)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Lumican (LUM). This antibody is labeled with Cy3.

Lumican (LUM) Polyclonal Antibody (Human), FITC

  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LUM (Gln19~Asn338)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Lumican (LUM). This antibody is labeled with FITC.

Lumican (LUM) Polyclonal Antibody (Human), HRP

  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LUM (Gln19~Asn338)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Lumican (LUM). This antibody is labeled with HRP.

Lumican (LUM) Polyclonal Antibody (Human), PE

  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LUM (Gln19~Asn338)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Lumican (LUM). This antibody is labeled with PE.

Lumican (LUM) Polyclonal Antibody (Mouse), APC

  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LUM (Gln19~Asn338)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Lumican (LUM). This antibody is labeled with APC.

Lumican (LUM) Polyclonal Antibody (Mouse), Biotinylated

  • EUR 307.00
  • EUR 2407.00
  • EUR 714.00
  • EUR 375.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LUM (Gln19~Asn338)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Lumican (LUM). This antibody is labeled with Biotin.

Lumican (LUM) Polyclonal Antibody (Mouse), Cy3

  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LUM (Gln19~Asn338)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Lumican (LUM). This antibody is labeled with Cy3.

Lumican (LUM) Polyclonal Antibody (Mouse), FITC

  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LUM (Gln19~Asn338)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Lumican (LUM). This antibody is labeled with FITC.

Lumican (LUM) Polyclonal Antibody (Mouse), HRP

  • EUR 311.00
  • EUR 2792.00
  • EUR 791.00
  • EUR 391.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LUM (Gln19~Asn338)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Lumican (LUM). This antibody is labeled with HRP.

Lumican (LUM) Polyclonal Antibody (Mouse), PE

  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LUM (Gln19~Asn338)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Lumican (LUM). This antibody is labeled with PE.

Rabbit Lumican, LUM ELISA KIT

ELI-04936Ra 96 Tests
EUR 928

Rabbit Lumican (LUM) ELISA Kit

abx355262-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Lumican (LUM) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Lumican (LUM) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Lumican (LUM) Antibody

  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Lumican (LUM) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Lumican (LUM) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Lumican (LUM) Antibody

  • EUR 328.00
  • EUR 815.00
  • EUR 425.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

Lumican (LUM) Antibody

abx033510-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Lumican (LUM) Antibody

abx033510-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Lumican (LUM) Antibody

abx033511-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Lumican (LUM) Antibody

abx033511-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

LUM Conjugated Antibody

C36591 100ul
EUR 397

Lumican (Lum) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Lumican (LUM) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Lumican (LUM) Antibody

abx234890-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Lumican (LUM) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Anti-LUM antibody

STJ27305 100 µl
EUR 277
Description: This gene encodes a member of the small leucine-rich proteoglycan (SLRP) family that includes decorin, biglycan, fibromodulin, keratocan, epiphycan, and osteoglycin. In these bifunctional molecules, the protein moiety binds collagen fibrils and the highly charged hydrophilic glycosaminoglycans regulate interfibrillar spacings. Lumican is the major keratan sulfate proteoglycan of the cornea but is also distributed in interstitial collagenous matrices throughout the body. Lumican may regulate collagen fibril organization and circumferential growth, corneal transparency, and epithelial cell migration and tissue repair.

Anti-LUM antibody

STJ192338 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to LUM

Lum/ Rat Lum ELISA Kit

ELI-04935r 96 Tests
EUR 886

Lumican (LUM) Polyclonal Antibody (Human), APC-Cy7

  • EUR 547.00
  • EUR 6106.00
  • EUR 1624.00
  • EUR 727.00
  • EUR 310.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LUM (Gln19~Asn338)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Lumican (LUM). This antibody is labeled with APC-Cy7.

Lumican (LUM) Polyclonal Antibody (Mouse), APC-Cy7

  • EUR 560.00
  • EUR 6286.00
  • EUR 1669.00
  • EUR 745.00
  • EUR 315.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LUM (Gln19~Asn338)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Lumican (LUM). This antibody is labeled with APC-Cy7.

Lum Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Lum. Recognizes Lum from Rat. This antibody is HRP conjugated. Tested in the following application: ELISA

Lum Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Lum. Recognizes Lum from Rat. This antibody is FITC conjugated. Tested in the following application: ELISA

Lum Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Lum. Recognizes Lum from Rat. This antibody is Biotin conjugated. Tested in the following application: ELISA

Lumican (LUM) Antibody (Biotin)

  • EUR 439.00
  • EUR 244.00
  • EUR 1261.00
  • EUR 606.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Lumican (LUM) Antibody (Biotin)

  • EUR 467.00
  • EUR 244.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Lumican (Lum) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Lumican (Lum) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Lumican (Lum) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Lumican (LUM) Antibody (FITC)

  • EUR 495.00
  • EUR 258.00
  • EUR 1469.00
  • EUR 690.00
  • EUR 398.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

LUM Blocking Peptide

33R-1163 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of C9orf96 antibody, catalog no. 70R-1210

Rat Lumican (Lum)

  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 40.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Lumican(Lum) expressed in E.coli

Rat Lumican (Lum)

  • EUR 293.00
  • EUR 963.00
  • EUR 409.00
  • EUR 717.00
  • 100ug
  • 1MG
  • 200ug
  • 500ug
  • MW: 40.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Lumican(Lum) expressed in Mammalian cell

LUM Blocking Peptide

DF7293-BP 1mg
EUR 195

LUM cloning plasmid

CSB-CL013234HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1017
  • Sequence: atgagtctaagtgcatttactctcttcctggcattgattggtggtaccagtggccagtactatgattatgattttcccctatcaatttatgggcaatcatcaccaaactgtgcaccagaatgtaactgccctgaaagctacccaagtgccatgtactgtgatgagctgaaattga
  • Show more
Description: A cloning plasmid for the LUM gene.

LUM cloning plasmid

CSB-CL013234HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1017
  • Sequence: atgagtctaagtgcatttactctcttcctggcattgattggtggtaccagtggccagtactatgattatgattttcccctatcaatttatgggcaatcatcaccaaactgtgcaccagaatgtaactgccctgaaagctacccaagtgccatgtactgtgatgagctgaaattga
  • Show more
Description: A cloning plasmid for the LUM gene.

Recombinant Lumican (LUM)

  • EUR 368.80
  • EUR 202.00
  • EUR 1108.00
  • EUR 436.00
  • EUR 772.00
  • EUR 310.00
  • EUR 2620.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P51884
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 38.1kDa
  • Isoelectric Point: 6.3
Description: Recombinant Human Lumican expressed in: E.coli

Recombinant Lumican (LUM)

  • EUR 470.94
  • EUR 229.00
  • EUR 1491.04
  • EUR 563.68
  • EUR 1027.36
  • EUR 378.00
  • EUR 3577.60
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P51885
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 37.8kDa
  • Isoelectric Point: 6.2
Description: Recombinant Mouse Lumican expressed in: E.coli

Lumican (LUM) Monoclonal Antibody (Human)

  • EUR 247.00
  • EUR 2523.00
  • EUR 628.00
  • EUR 311.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Gln19~Asn338
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Lumican (LUM)

Lumican (LUM) Monoclonal Antibody (Human), APC

  • EUR 346.00
  • EUR 3293.00
  • EUR 917.00
  • EUR 441.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Gln19~Asn338
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Lumican (LUM). This antibody is labeled with APC.

Lumican (LUM) Monoclonal Antibody (Human), Biotinylated

  • EUR 312.00
  • EUR 2473.00
  • EUR 730.00
  • EUR 382.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Gln19~Asn338
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Lumican (LUM). This antibody is labeled with Biotin.

Lumican (LUM) Monoclonal Antibody (Human), Cy3

  • EUR 420.00
  • EUR 4349.00
  • EUR 1181.00
  • EUR 547.00
  • EUR 252.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Gln19~Asn338
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Lumican (LUM). This antibody is labeled with Cy3.

Lumican (LUM) Monoclonal Antibody (Human), FITC

  • EUR 297.00
  • EUR 2654.00
  • EUR 753.00
  • EUR 373.00
  • EUR 196.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Gln19~Asn338
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Lumican (LUM). This antibody is labeled with FITC.

Lumican (LUM) Monoclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2870.00
  • EUR 811.00
  • EUR 399.00
  • EUR 207.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Gln19~Asn338
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Lumican (LUM). This antibody is labeled with HRP.

Lumican (LUM) Monoclonal Antibody (Human), PE

  • EUR 297.00
  • EUR 2654.00
  • EUR 753.00
  • EUR 373.00
  • EUR 196.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Gln19~Asn338
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Lumican (LUM). This antibody is labeled with PE.

LUM protein (His tag)

80R-3624 100 ug
EUR 327
Description: Purified recombinant LUM protein (His tag)

Human Lumican (LUM) Protein

  • EUR 523.00
  • EUR 244.00
  • EUR 1497.00
  • EUR 606.00
  • EUR 384.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Mouse Lumican (LUM) Protein

  • EUR 662.00
  • EUR 272.00
  • EUR 2012.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.


ELA-E1496h 96 Tests
EUR 824


EF000178 96 Tests
EUR 689

Rat LUM shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human LUM shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse LUM shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

LUM Recombinant Protein (Human)

RP018424 100 ug Ask for price

LUM Recombinant Protein (Human)

RP018427 100 ug Ask for price

LUM Recombinant Protein (Mouse)

RP148628 100 ug Ask for price

LUM Recombinant Protein (Rat)

RP210287 100 ug Ask for price

LUM Rabbit Polyclonal Antibody

Recent Posts


January 2022
