Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG

fallback-image

MICA Rabbit Polyclonal Antibody

MICA Rabbit Polyclonal Antibody

Contact us: [email protected]

MICA Polyclonal Antibody

ES11174-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MICA from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

MICA Polyclonal Antibody

ES11174-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MICA from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

MICA Rabbit pAb

A1390-100ul 100 ul
EUR 308

MICA Rabbit pAb

A1390-200ul 200 ul
EUR 459

MICA Rabbit pAb

A1390-20ul 20 ul
EUR 183

MICA Rabbit pAb

A1390-50ul 50 ul
EUR 223

MICA Rabbit pAb

A12622-100ul 100 ul
EUR 308

MICA Rabbit pAb

A12622-200ul 200 ul
EUR 459

MICA Rabbit pAb

A12622-20ul 20 ul
EUR 183

MICA Rabbit pAb

A12622-50ul 50 ul
EUR 223

Polyclonal MICA Antibody (Center)

APR06106G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MICA (Center). This antibody is tested and proven to work in the following applications:

MICA Antibody

24546-100ul 100ul
EUR 390

MICA antibody

70R-1705 100 ug
EUR 377
Description: Rabbit polyclonal MICA antibody raised against the middle region of MICA

MICA antibody

70R-18509 50 ul
EUR 435
Description: Rabbit polyclonal MICA antibody

MICA antibody

38237-100ul 100ul
EUR 252

MICA antibody

10R-6540 100 ug
EUR 208
Description: Mouse monoclonal MICA antibody

MICA Antibody

DF6403 200ul
EUR 304
Description: MICA Antibody detects endogenous levels of total MICA.

MICA Antibody

1-CSB-PA013806ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against MICA. Recognizes MICA from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:200-1:1000, IHC:1:20-1:200

MICA Antibody

1-CSB-PA013806ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against MICA. Recognizes MICA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

MICA Antibody

1-CSB-PA013806GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against MICA. Recognizes MICA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB

MICA antibody

70R-6091 50 ug
EUR 467
Description: Rabbit polyclonal MICA antibody raised against the N terminal of MICA

MICA Antibody

ABD6403 100 ug
EUR 438

Polyclonal MICA Antibody (C-Terminus)

APR02372G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MICA (C-Terminus). This antibody is tested and proven to work in the following applications:

MICA Conjugated Antibody

C38237 100ul
EUR 397

anti- MICA antibody

FNab05176 100µg
EUR 585
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: MHC class I polypeptide-related sequence A
  • Uniprot ID: Q29983
  • Gene ID: 100507436
  • Research Area: Immunology
Description: Antibody raised against MICA

Anti-MICA antibody

PAab05176 100 ug
EUR 412

Anti-MICA Antibody

PB9612 100ug/vial
EUR 294

Anti-MICA antibody

STJ24550 100 µl
EUR 277
Description: This gene encodes the highly polymorphic major histocompatability complex class I chain-related protein A. The protein product is expressed on the cell surface, although unlike canonical class I molecules it does not seem to associate with beta-2-microglobulin. It is a ligand for the NKG2-D type II integral membrane protein receptor. The protein functions as a stress-induced antigen that is broadly recognized by intestinal epithelial gamma delta T cells. Variations in this gene have been associated with susceptibility to psoriasis 1 and psoriatic arthritis, and the shedding of MICA-related antibodies and ligands is involved in the progression from monoclonal gammopathy of undetermined significance to multiple myeloma. Alternative splicing of this gene results in multiple transcript variants.

Anti-MICA antibody

STJ114496 100 µl
EUR 277
Description: This gene encodes the highly polymorphic major histocompatability complex class I chain-related protein A. The protein product is expressed on the cell surface, although unlike canonical class I molecules it does not seem to associate with beta-2-microglobulin. It is a ligand for the NKG2-D type II integral membrane protein receptor. The protein functions as a stress-induced antigen that is broadly recognized by intestinal epithelial gamma delta T cells. Variations in this gene have been associated with susceptibility to psoriasis 1 and psoriatic arthritis, and the shedding of MICA-related antibodies and ligands is involved in the progression from monoclonal gammopathy of undetermined significance to multiple myeloma. Alternative splicing of this gene results in multiple transcript variants.

Anti-MICA antibody

STJ192332 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to MICA

MICA siRNA

20-abx924137
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-MICA

YF-PA13161 50 ug
EUR 363
Description: Mouse polyclonal to MICA

anti-MICA

YF-PA13162 100 ug
EUR 403
Description: Rabbit polyclonal to MICA

MICA Blocking Peptide

33R-5029 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MICA antibody, catalog no. 70R-6091

MICA Blocking Peptide

33R-5386 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MICA antibody, catalog no. 70R-1705

MICA Blocking Peptide

DF6403-BP 1mg
EUR 195

MICA cloning plasmid

CSB-CL013806HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1152
  • Sequence: atggggctgggcccggtcttcctgcttctggctggcatcttcccttttgcacctccgggagctgctgctgagccccacagtcttcgttataacctcacggtgctgtcctgggatggatctgtgcagtcagggtttctcactgaggtacatctggatggtcagcccttcctgcgct
  • Show more
Description: A cloning plasmid for the MICA gene.

pDONR223-MICA Plasmid

PVTB00776 2 ug
EUR 356

pCMV-SPORT6-MICA

PVT13890 2 ug
EUR 391

Anti-MICA/MICB Purified

11-822-C100 0.1 mg
EUR 195

Anti-MICA/MICB APC

1A-822-C100 0.1 mg
EUR 331

Anti-MICA/MICB Biotin

1B-822-C100 0.1 mg
EUR 277

Anti-MICA/MICB FITC

1F-822-C100 0.1 mg
EUR 277

Anti-MICA/MICB PE

1P-822-C100 0.1 mg
EUR 331

Human MICA ELISA Kit

55R-1759 1 kit
EUR 651
Description: ELISA kit for detection of MICA in the research laboratory

MICA protein (His tag)

80R-4185 50 ug
EUR 435
Description: Recombinant Human MICA protein (His tag)

Human MICA ELISA Kit

ELA-E1845h 96 Tests
EUR 824

MICA ELISA KIT|Human

EF000010 96 Tests
EUR 689

Human MICA shRNA Plasmid

20-abx968935
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human MICA ELISA kit

LF-EK50525 1×96T
EUR 648

pCMV-SPORT6.1-MICA Plasmid

PVT16915 2 ug
EUR 325

Recombinant Human MICA Protein

RP00172 5 μg
EUR 136

ELISA kit for Human MICA

EK5359 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human MICA in samples from serum, plasma, tissue homogenates and other biological fluids.

Human MICA PicoKine ELISA Kit

EK0812 96 wells
EUR 456
Description: For quantitative detection of human MICA in cell culture supernates, cell lysates and serum.

Anti-MICA/MICB Alexa Fluor647

A6-822-C100 0.1 mg
EUR 373

Anti-MICA/MICB Alexa Fluor700

A7-822-C100 0.1 mg
EUR 373

Human MICA ELISA kit (4X96T)

LF-EK50526 4×96T
EUR 2201

MICA ORF Vector (Human) (pORF)

ORF006484 1.0 ug DNA
EUR 95

Anti-MICA/MICB PE-Cy7

T7-822-C100 0.1 mg
EUR 368

MICA ELISA Kit (Human) (OKBB00330)

OKBB00330 96 Tests
EUR 748
Description: Description of target: MHC class I polypeptide-related sequence A is a protein that in humans is encoded by the MICA gene.1 The MICA gene encodes a 383-amino acid polypeptide with a predicted mass of 43 kD.The MICA and MICB genes occur in a 200-kb region spanning the TNFA and TNFB cluster at 6p21.3.2 MICA and the closely related MICB were recognized by intestinal epithelial T cells expressing diverse V-delta-1 gamma/delta TCRs.3 The MICA protein product is expressed on the cell surface, although unlike canonical class I molecules does not seem to associate with beta-2-microglobulin. It is further distinguished by its unusual exon-intron organization and preferential expression in fibroblasts and epithelial cells. It is thought that MICA functions as a stress-induced antigen that is broadly recognized by NK cells, NKT cells, and most of the subtypes of T cells. MICA and other members of this family may have been selected for specialized functions that are either ancient or derived from those of typical MHC class I genes, in analogy to some of the nonclassic mouse H-2 genes. The standard product used in this kit is recombinant MICA, which is composed of 286 amino acids with the molecular mass of 59KDa.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 10 pg/ml

MICA sgRNA CRISPR Lentivector set (Human)

K1301101 3 x 1.0 ug
EUR 339

MHC Class I Chain-Related Protein A (MICA) Antibody

20-abx113731
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

MHC Class I Polypeptide Related Sequence A (MICA) Antibody

abx034034-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

MHC Class I Polypeptide Related Sequence A (MICA) Antibody

abx034034-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

MHC Class I Polypeptide Related Sequence A (MICA) Antibody

20-abx320234
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

MHC Class I Polypeptide Related Sequence A (MICA) Antibody

abx235176-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

MHC Class I Polypeptide Related Sequence A (MICA) Antibody

20-abx322185
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

MHC Class I Polypeptide Related Sequence A (MICA) Antibody

20-abx225291
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

MHC Class I Polypeptide Related Sequence A (MICA) Antibody

20-abx001216
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

MICA sgRNA CRISPR Lentivector (Human) (Target 1)

K1301102 1.0 ug DNA
EUR 154

MICA sgRNA CRISPR Lentivector (Human) (Target 2)

K1301103 1.0 ug DNA
EUR 154

MICA sgRNA CRISPR Lentivector (Human) (Target 3)

K1301104 1.0 ug DNA
EUR 154

MICA Protein Vector (Human) (pPB-C-His)

PV025933 500 ng
EUR 329

MICA Protein Vector (Human) (pPB-N-His)

PV025934 500 ng
EUR 329

MICA Protein Vector (Human) (pPM-C-HA)

PV025935 500 ng
EUR 329

MICA Protein Vector (Human) (pPM-C-His)

PV025936 500 ng
EUR 329

Recombinant Human MICA Protein, His, E.coli-100ug

QP10171-ec-100ug 100ug
EUR 1178

Recombinant Human MICA Protein, His, E.coli-10ug

QP10171-ec-10ug 10ug
EUR 154

Recombinant Human MICA Protein, His, E.coli-250ug

QP10171-ec-250ug 250ug
EUR 2067

Recombinant Human MICA Protein, His, E.coli-50ug

QP10171-ec-50ug 50ug
EUR 290

Recombinant Human MICA Protein, Untagged, E.coli-10ug

QP10172-ec-10ug 10ug
EUR 154

Recombinant Human MICA Protein, Untagged, E.coli-50ug

QP10172-ec-50ug 50ug
EUR 290

MICA 3'UTR GFP Stable Cell Line

TU063343 1.0 ml
EUR 1394

MICA 3'UTR Luciferase Stable Cell Line

TU013343 1.0 ml
EUR 1394

MICA ELISA Kit (Human) : 96 Wells (OKEH02830)

OKEH02830 96 Wells
EUR 662
Description: Description of target: This gene encodes the highly polymorphic major histocompatability complex class I chain-related protein A. The protein product is expressed on the cell surface, although unlike canonical class I molecules it does not seem to associate with beta-2-microglobulin. It is a ligand for the NKG2-D type II integral membrane protein receptor. The protein functions as a stress-induced antigen that is broadly recognized by intestinal epithelial gamma delta T cells. Variations in this gene have been associated with susceptibility to psoriasis 1 and psoriatic arthritis, and the shedding of MICA-related antibodies and ligands is involved in the progression from monoclonal gammopathy of undetermined significance to multiple myeloma. Alternative splicing of this gene results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 33 pg/mL

Human MICA Protein (Glu 24-Gln 308) [His]

VAng-2565Lsx-100g 100 µg
EUR 738
Description: Human MICA protein, His tag, was expressed in human 293 cells. (Uniprot ID: NP_000238)

Human MICA Protein (Glu 24-Gln 308) [His]

VAng-2565Lsx-1mg 1 mg
EUR 4174
Description: Human MICA protein, His tag, was expressed in human 293 cells. (Uniprot ID: NP_000238)

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

MICA Rabbit Polyclonal Antibody

Recent Posts

Categories

January 2022
M T W T F S S
 12
3456789
10111213141516
17181920212223
24252627282930
31  

Pages