MICA Rabbit Polyclonal Antibody
Contact us: [email protected]
 MICA Polyclonal Antibody |
|
ES11174-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MICA from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
MICA Polyclonal Antibody |
|
ES11174-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MICA from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
 MICA Rabbit pAb |
|
A1390-100ul |
Abclonal |
100 ul |
EUR 308 |
MICA Rabbit pAb |
|
A1390-200ul |
Abclonal |
200 ul |
EUR 459 |
MICA Rabbit pAb |
|
A1390-20ul |
Abclonal |
20 ul |
EUR 183 |
MICA Rabbit pAb |
|
A1390-50ul |
Abclonal |
50 ul |
EUR 223 |
MICA Rabbit pAb |
|
A12622-100ul |
Abclonal |
100 ul |
EUR 308 |
MICA Rabbit pAb |
|
A12622-200ul |
Abclonal |
200 ul |
EUR 459 |
MICA Rabbit pAb |
|
A12622-20ul |
Abclonal |
20 ul |
EUR 183 |
MICA Rabbit pAb |
|
A12622-50ul |
Abclonal |
50 ul |
EUR 223 |
) Polyclonal MICA Antibody (Center) |
|
APR06106G |
Leading Biology |
0.1ml |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MICA (Center). This antibody is tested and proven to work in the following applications: |
 MICA Antibody |
|
24546-100ul |
SAB |
100ul |
EUR 390 |
 MICA antibody |
|
70R-1705 |
Fitzgerald |
100 ug |
EUR 377 |
|
Description: Rabbit polyclonal MICA antibody raised against the middle region of MICA |
MICA antibody |
|
70R-18509 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal MICA antibody |
MICA antibody |
|
38237-100ul |
SAB |
100ul |
EUR 252 |
MICA antibody |
|
10R-6540 |
Fitzgerald |
100 ug |
EUR 208 |
|
Description: Mouse monoclonal MICA antibody |
MICA Antibody |
|
DF6403 |
Affbiotech |
200ul |
EUR 304 |
|
Description: MICA Antibody detects endogenous levels of total MICA. |
MICA Antibody |
|
1-CSB-PA013806ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against MICA. Recognizes MICA from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:200-1:1000, IHC:1:20-1:200 |
MICA Antibody |
|
1-CSB-PA013806ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against MICA. Recognizes MICA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
MICA Antibody |
|
1-CSB-PA013806GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against MICA. Recognizes MICA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
MICA antibody |
|
70R-6091 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Rabbit polyclonal MICA antibody raised against the N terminal of MICA |
) Polyclonal MICA Antibody (C-Terminus) |
|
APR02372G |
Leading Biology |
0.05mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MICA (C-Terminus). This antibody is tested and proven to work in the following applications: |
 MICA Conjugated Antibody |
|
C38237 |
SAB |
100ul |
EUR 397 |
 anti- MICA antibody |
|
FNab05176 |
FN Test |
100µg |
EUR 585 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:200
- Immunogen: MHC class I polypeptide-related sequence A
- Uniprot ID: Q29983
- Gene ID: 100507436
- Research Area: Immunology
|
|
Description: Antibody raised against MICA |
 Anti-MICA Antibody |
|
PB9612 |
BosterBio |
100ug/vial |
EUR 294 |
 Anti-MICA antibody |
|
STJ24550 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: This gene encodes the highly polymorphic major histocompatability complex class I chain-related protein A. The protein product is expressed on the cell surface, although unlike canonical class I molecules it does not seem to associate with beta-2-microglobulin. It is a ligand for the NKG2-D type II integral membrane protein receptor. The protein functions as a stress-induced antigen that is broadly recognized by intestinal epithelial gamma delta T cells. Variations in this gene have been associated with susceptibility to psoriasis 1 and psoriatic arthritis, and the shedding of MICA-related antibodies and ligands is involved in the progression from monoclonal gammopathy of undetermined significance to multiple myeloma. Alternative splicing of this gene results in multiple transcript variants. |
Anti-MICA antibody |
|
STJ114496 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: This gene encodes the highly polymorphic major histocompatability complex class I chain-related protein A. The protein product is expressed on the cell surface, although unlike canonical class I molecules it does not seem to associate with beta-2-microglobulin. It is a ligand for the NKG2-D type II integral membrane protein receptor. The protein functions as a stress-induced antigen that is broadly recognized by intestinal epithelial gamma delta T cells. Variations in this gene have been associated with susceptibility to psoriasis 1 and psoriatic arthritis, and the shedding of MICA-related antibodies and ligands is involved in the progression from monoclonal gammopathy of undetermined significance to multiple myeloma. Alternative splicing of this gene results in multiple transcript variants. |
Anti-MICA antibody |
|
STJ192332 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to MICA |
 MICA siRNA |
|
20-abx924137 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-MICA |
|
YF-PA13161 |
Abfrontier |
50 ug |
EUR 363 |
|
Description: Mouse polyclonal to MICA |
anti-MICA |
|
YF-PA13162 |
Abfrontier |
100 ug |
EUR 403 |
|
Description: Rabbit polyclonal to MICA |
 MICA Blocking Peptide |
|
33R-5029 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MICA antibody, catalog no. 70R-6091 |
MICA Blocking Peptide |
|
33R-5386 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MICA antibody, catalog no. 70R-1705 |
MICA Blocking Peptide |
|
DF6403-BP |
Affbiotech |
1mg |
EUR 195 |
 MICA cloning plasmid |
|
CSB-CL013806HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1152
- Sequence: atggggctgggcccggtcttcctgcttctggctggcatcttcccttttgcacctccgggagctgctgctgagccccacagtcttcgttataacctcacggtgctgtcctgggatggatctgtgcagtcagggtttctcactgaggtacatctggatggtcagcccttcctgcgct
- Show more
|
|
Description: A cloning plasmid for the MICA gene. |
 Anti-MICA/MICB Purified |
|
11-822-C100 |
ExBio |
0.1 mg |
EUR 195 |
 Anti-MICA/MICB APC |
|
1A-822-C100 |
ExBio |
0.1 mg |
EUR 331 |
 Anti-MICA/MICB Biotin |
|
1B-822-C100 |
ExBio |
0.1 mg |
EUR 277 |
 Anti-MICA/MICB FITC |
|
1F-822-C100 |
ExBio |
0.1 mg |
EUR 277 |
 Anti-MICA/MICB PE |
|
1P-822-C100 |
ExBio |
0.1 mg |
EUR 331 |
 Human MICA ELISA Kit |
|
55R-1759 |
Fitzgerald |
1 kit |
EUR 651 |
|
Description: ELISA kit for detection of MICA in the research laboratory |
) MICA protein (His tag) |
|
80R-4185 |
Fitzgerald |
50 ug |
EUR 435 |
|
Description: Recombinant Human MICA protein (His tag) |
 Human MICA shRNA Plasmid |
|
20-abx968935 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human MICA ELISA kit |
|
LF-EK50525 |
Abfrontier |
1×96T |
EUR 648 |
 Recombinant Human MICA Protein |
|
RP00172 |
Abclonal |
5 μg |
EUR 136 |
 ELISA kit for Human MICA |
|
EK5359 |
SAB |
96 tests |
EUR 553 |
|
Description: Enzyme-linked immunosorbent assay kit for quantification of Human MICA in samples from serum, plasma, tissue homogenates and other biological fluids. |
 Human MICA PicoKine ELISA Kit |
|
EK0812 |
BosterBio |
96 wells |
EUR 456 |
|
Description: For quantitative detection of human MICA in cell culture supernates, cell lysates and serum. |
 Anti-MICA/MICB Alexa Fluor647 |
|
A6-822-C100 |
ExBio |
0.1 mg |
EUR 373 |
 Anti-MICA/MICB Alexa Fluor700 |
|
A7-822-C100 |
ExBio |
0.1 mg |
EUR 373 |
) Human MICA ELISA kit (4X96T) |
|
LF-EK50526 |
Abfrontier |
4×96T |
EUR 2201 |
 (pORF)) MICA ORF Vector (Human) (pORF) |
|
ORF006484 |
ABM |
1.0 ug DNA |
EUR 95 |
 Anti-MICA/MICB PE-Cy7 |
|
T7-822-C100 |
ExBio |
0.1 mg |
EUR 368 |
 (OKBB00330)) MICA ELISA Kit (Human) (OKBB00330) |
|
OKBB00330 |
Aviva Systems Biology |
96 Tests |
EUR 748 |
|
Description: Description of target: MHC class I polypeptide-related sequence A is a protein that in humans is encoded by the MICA gene.1 The MICA gene encodes a 383-amino acid polypeptide with a predicted mass of 43 kD.The MICA and MICB genes occur in a 200-kb region spanning the TNFA and TNFB cluster at 6p21.3.2 MICA and the closely related MICB were recognized by intestinal epithelial T cells expressing diverse V-delta-1 gamma/delta TCRs.3 The MICA protein product is expressed on the cell surface, although unlike canonical class I molecules does not seem to associate with beta-2-microglobulin. It is further distinguished by its unusual exon-intron organization and preferential expression in fibroblasts and epithelial cells. It is thought that MICA functions as a stress-induced antigen that is broadly recognized by NK cells, NKT cells, and most of the subtypes of T cells. MICA and other members of this family may have been selected for specialized functions that are either ancient or derived from those of typical MHC class I genes, in analogy to some of the nonclassic mouse H-2 genes. The standard product used in this kit is recombinant MICA, which is composed of 286 amino acids with the molecular mass of 59KDa.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 10 pg/ml |
) MICA sgRNA CRISPR Lentivector set (Human) |
|
K1301101 |
ABM |
3 x 1.0 ug |
EUR 339 |
 Antibody) MHC Class I Chain-Related Protein A (MICA) Antibody |
|
20-abx113731 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 Antibody) MHC Class I Polypeptide Related Sequence A (MICA) Antibody |
|
abx034034-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
MHC Class I Polypeptide Related Sequence A (MICA) Antibody |
|
abx034034-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
MHC Class I Polypeptide Related Sequence A (MICA) Antibody |
|
20-abx320234 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MHC Class I Polypeptide Related Sequence A (MICA) Antibody |
|
abx235176-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
MHC Class I Polypeptide Related Sequence A (MICA) Antibody |
|
20-abx322185 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MHC Class I Polypeptide Related Sequence A (MICA) Antibody |
|
20-abx225291 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
MHC Class I Polypeptide Related Sequence A (MICA) Antibody |
|
20-abx001216 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
 (Target 1)) MICA sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K1301102 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) MICA sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K1301103 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) MICA sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K1301104 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) MICA Protein Vector (Human) (pPB-C-His) |
|
PV025933 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) MICA Protein Vector (Human) (pPB-N-His) |
|
PV025934 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) MICA Protein Vector (Human) (pPM-C-HA) |
|
PV025935 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) MICA Protein Vector (Human) (pPM-C-His) |
|
PV025936 |
ABM |
500 ng |
EUR 329 |
 Recombinant Human MICA Protein, His, E.coli-100ug |
|
QP10171-ec-100ug |
EnQuireBio |
100ug |
EUR 1178 |
 Recombinant Human MICA Protein, His, E.coli-10ug |
|
QP10171-ec-10ug |
EnQuireBio |
10ug |
EUR 154 |
 Recombinant Human MICA Protein, His, E.coli-250ug |
|
QP10171-ec-250ug |
EnQuireBio |
250ug |
EUR 2067 |
 Recombinant Human MICA Protein, His, E.coli-50ug |
|
QP10171-ec-50ug |
EnQuireBio |
50ug |
EUR 290 |
 Recombinant Human MICA Protein, Untagged, E.coli-10ug |
|
QP10172-ec-10ug |
EnQuireBio |
10ug |
EUR 154 |
 Recombinant Human MICA Protein, Untagged, E.coli-50ug |
|
QP10172-ec-50ug |
EnQuireBio |
50ug |
EUR 290 |
 MICA 3'UTR GFP Stable Cell Line |
|
TU063343 |
ABM |
1.0 ml |
EUR 1394 |
 MICA 3'UTR Luciferase Stable Cell Line |
|
TU013343 |
ABM |
1.0 ml |
EUR 1394 |
 : 96 Wells (OKEH02830)) MICA ELISA Kit (Human) : 96 Wells (OKEH02830) |
|
OKEH02830 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
|
Description: Description of target: This gene encodes the highly polymorphic major histocompatability complex class I chain-related protein A. The protein product is expressed on the cell surface, although unlike canonical class I molecules it does not seem to associate with beta-2-microglobulin. It is a ligand for the NKG2-D type II integral membrane protein receptor. The protein functions as a stress-induced antigen that is broadly recognized by intestinal epithelial gamma delta T cells. Variations in this gene have been associated with susceptibility to psoriasis 1 and psoriatic arthritis, and the shedding of MICA-related antibodies and ligands is involved in the progression from monoclonal gammopathy of undetermined significance to multiple myeloma. Alternative splicing of this gene results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 33 pg/mL |
 [His]) Human MICA Protein (Glu 24-Gln 308) [His] |
|
VAng-2565Lsx-100g |
Creative Biolabs |
100 µg |
EUR 738 |
|
Description: Human MICA protein, His tag, was expressed in human 293 cells. (Uniprot ID: NP_000238) |
Human MICA Protein (Glu 24-Gln 308) [His] |
|
VAng-2565Lsx-1mg |
Creative Biolabs |
1 mg |
EUR 4174 |
|
Description: Human MICA protein, His tag, was expressed in human 293 cells. (Uniprot ID: NP_000238) |
 GAPDH Rabbit Polyclonal Antibody |
|
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
|
37985-50ul |
SAB |
50ul |
EUR 187 |
 EFHD1 Rabbit Polyclonal Antibody |
|
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
|
38001-50ul |
SAB |
50ul |
EUR 187 |
 Alliinase Rabbit Polyclonal Antibody |
|
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
|
38042-50ul |
SAB |
50ul |
EUR 187 |
 ECFP Rabbit Polyclonal Antibody |
|
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
|
38077-50ul |
SAB |
50ul |
EUR 187 |
MICA Rabbit Polyclonal Antibody
