Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG

fallback-image

DHX58 Rabbit Polyclonal Antibody

DHX58 Rabbit Polyclonal Antibody

Contact us: [email protected]

DHX58 Polyclonal Antibody

ABP58368-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human DHX58 protein at amino acid sequence of 451-500
  • Applications tips:
Description: A polyclonal antibody for detection of DHX58 from Human, Mouse. This DHX58 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DHX58 protein at amino acid sequence of 451-500

DHX58 Polyclonal Antibody

ES11437-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against DHX58 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

DHX58 Polyclonal Antibody

ES11437-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against DHX58 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

DHX58 Rabbit pAb

A8257-100ul 100 ul
EUR 308

DHX58 Rabbit pAb

A8257-200ul 200 ul
EUR 459

DHX58 Rabbit pAb

A8257-20ul 20 ul
EUR 183

DHX58 Rabbit pAb

A8257-50ul 50 ul
EUR 223

DHX58 antibody

70R-16832 50 ul
EUR 435
Description: Rabbit polyclonal DHX58 antibody

DHX58 Antibody

48413-100ul 100ul
EUR 333

DHX58 Antibody

48413-50ul 50ul
EUR 239

DHX58 Antibody

1-CSB-PA822187ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against DHX58. Recognizes DHX58 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

DHX58 Antibody

1-CSB-PA006884GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against DHX58. Recognizes DHX58 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

DHX58 antibody

70R-4734 50 ug
EUR 467
Description: Rabbit polyclonal DHX58 antibody

Polyclonal DHX58 / LGP2 Antibody (Internal)

APR02528G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DHX58 / LGP2 (Internal). This antibody is tested and proven to work in the following applications:

Polyclonal DHX58 Antibody (N-term)

APR05647G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DHX58 (N-term). This antibody is tested and proven to work in the following applications:

Rabbit Probable ATP dependent RNA helicase DHX58(DHX58) ELISA kit

E04P0789-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Probable ATP dependent RNA helicase DHX58(DHX58) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Probable ATP dependent RNA helicase DHX58(DHX58) ELISA kit

E04P0789-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Probable ATP dependent RNA helicase DHX58(DHX58) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Probable ATP dependent RNA helicase DHX58(DHX58) ELISA kit

E04P0789-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Probable ATP dependent RNA helicase DHX58(DHX58) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

DHX58 Conjugated Antibody

C48413 100ul
EUR 397

Anti-DHX58 antibody

STJ110556 100 µl
EUR 277

Anti-DHX58 antibody

STJ192595 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to DHX58

DHX58 siRNA

20-abx914140
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DHX58 siRNA

20-abx914141
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-DHX58

YF-PA20754 50 ul
EUR 363
Description: Mouse polyclonal to DHX58

anti-DHX58

YF-PA20755 50 ug
EUR 363
Description: Mouse polyclonal to DHX58

anti-DHX58

YF-PA20756 100 ul
EUR 403
Description: Rabbit polyclonal to DHX58

anti-DHX58

YF-PA20757 100 ug
EUR 403
Description: Rabbit polyclonal to DHX58

DHX58 Blocking Peptide

33R-1634 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DHX58 antibody, catalog no. 70R-4734

DHX58 cloning plasmid

CSB-CL822187HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2037
  • Sequence: atggagcttcggtcctaccaatgggaggtgatcatgcctgccctggagggcaagaatatcatcatctggctgcccacgggtgccgggaagacccgggcggctgcttatgtggccaagcggcacctagagactgtggatggagccaaggtggttgtattggtcaacagggtgcacc
  • Show more
Description: A cloning plasmid for the DHX58 gene.

Rat Probable ATP dependent RNA helicase DHX58(DHX58) ELISA kit

E02P0789-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Probable ATP dependent RNA helicase DHX58(DHX58) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Probable ATP dependent RNA helicase DHX58(DHX58) ELISA kit

E02P0789-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Probable ATP dependent RNA helicase DHX58(DHX58) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Probable ATP dependent RNA helicase DHX58(DHX58) ELISA kit

E02P0789-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Probable ATP dependent RNA helicase DHX58(DHX58) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Probable ATP dependent RNA helicase DHX58(DHX58) ELISA kit

E03P0789-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Probable ATP dependent RNA helicase DHX58(DHX58) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Probable ATP dependent RNA helicase DHX58(DHX58) ELISA kit

E03P0789-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Probable ATP dependent RNA helicase DHX58(DHX58) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Probable ATP dependent RNA helicase DHX58(DHX58) ELISA kit

E03P0789-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Probable ATP dependent RNA helicase DHX58(DHX58) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Probable ATP dependent RNA helicase DHX58(DHX58) ELISA kit

E01P0789-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Probable ATP dependent RNA helicase DHX58(DHX58) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Probable ATP dependent RNA helicase DHX58(DHX58) ELISA kit

E01P0789-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Probable ATP dependent RNA helicase DHX58(DHX58) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Probable ATP dependent RNA helicase DHX58(DHX58) ELISA kit

E01P0789-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Probable ATP dependent RNA helicase DHX58(DHX58) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Probable ATP dependent RNA helicase DHX58(DHX58) ELISA kit

E06P0789-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Probable ATP dependent RNA helicase DHX58(DHX58) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Probable ATP dependent RNA helicase DHX58(DHX58) ELISA kit

E06P0789-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Probable ATP dependent RNA helicase DHX58(DHX58) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Probable ATP dependent RNA helicase DHX58(DHX58) ELISA kit

E06P0789-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Probable ATP dependent RNA helicase DHX58(DHX58) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Probable ATP-Dependent RNA Helicase DHX58 (DHX58) ELISA Kit

abx259676-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Dog Probable ATP dependent RNA helicase DHX58(DHX58) ELISA kit

E08P0789-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Probable ATP dependent RNA helicase DHX58(DHX58) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Probable ATP dependent RNA helicase DHX58(DHX58) ELISA kit

E08P0789-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Probable ATP dependent RNA helicase DHX58(DHX58) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Probable ATP dependent RNA helicase DHX58(DHX58) ELISA kit

E08P0789-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Probable ATP dependent RNA helicase DHX58(DHX58) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Probable ATP dependent RNA helicase DHX58(DHX58) ELISA kit

E07P0789-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Probable ATP dependent RNA helicase DHX58(DHX58) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Probable ATP dependent RNA helicase DHX58(DHX58) ELISA kit

E07P0789-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Probable ATP dependent RNA helicase DHX58(DHX58) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Probable ATP dependent RNA helicase DHX58(DHX58) ELISA kit

E07P0789-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Probable ATP dependent RNA helicase DHX58(DHX58) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Probable ATP dependent RNA helicase DHX58(DHX58) ELISA kit

E09P0789-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Probable ATP dependent RNA helicase DHX58(DHX58) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Probable ATP dependent RNA helicase DHX58(DHX58) ELISA kit

E09P0789-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Probable ATP dependent RNA helicase DHX58(DHX58) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Probable ATP dependent RNA helicase DHX58(DHX58) ELISA kit

E09P0789-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Probable ATP dependent RNA helicase DHX58(DHX58) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Dhx58 ELISA KIT

ELI-08954m 96 Tests
EUR 865

Human DHX58 ELISA KIT

ELI-26381h 96 Tests
EUR 824

Mouse DHX58 shRNA Plasmid

20-abx979049
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human DHX58 shRNA Plasmid

20-abx962316
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pEGFP-C3-DHX58 Plasmid

PVTB00431-2a 2 ug
EUR 356

pCMV-Flag-DHX58 Plasmid

PVTB00431-2b 2 ug
EUR 356

pCMV-Myc-DHX58 Plasmid

PVTB00431-2c 2 ug
EUR 356

pCMV-HA-DHX58 Plasmid

PVTB00431-2d 2 ug
EUR 356

DHX58 Recombinant Protein (Human)

RP009331 100 ug Ask for price

DHX58 Recombinant Protein (Rat)

RP198041 100 ug Ask for price

DHX58 Recombinant Protein (Mouse)

RP129023 100 ug Ask for price

DExH-Box Helicase 58 (DHX58) Antibody

20-abx005768
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

DExH-Box Helicase 58 (DHX58) Antibody

20-abx112052
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

DExH-Box Helicase 58 (DHX58) Antibody

abx122721-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

DExH-Box Helicase 58 (DHX58) Antibody

abx032519-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

DExH-Box Helicase 58 (DHX58) Antibody

abx032519-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

DExH-Box Helicase 58 (DHX58) Antibody

20-abx322743
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

DExH-Box Helicase 58 (DHX58) Antibody

abx224408-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

Guinea pig Probable ATP dependent RNA helicase DHX58(DHX58) ELISA kit

E05P0789-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Probable ATP dependent RNA helicase DHX58(DHX58) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Probable ATP dependent RNA helicase DHX58(DHX58) ELISA kit

E05P0789-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Probable ATP dependent RNA helicase DHX58(DHX58) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Probable ATP dependent RNA helicase DHX58(DHX58) ELISA kit

E05P0789-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Probable ATP dependent RNA helicase DHX58(DHX58) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dhx58 ORF Vector (Rat) (pORF)

ORF066015 1.0 ug DNA
EUR 506

DHX58 ORF Vector (Human) (pORF)

ORF003111 1.0 ug DNA
EUR 95

Dhx58 ORF Vector (Mouse) (pORF)

ORF043009 1.0 ug DNA
EUR 506

Probable ATP-Dependent RNA Helicase DDX58 (DHX58) Antibody

abx224285-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

Dhx58 sgRNA CRISPR Lentivector set (Rat)

K6062901 3 x 1.0 ug
EUR 339

DHX58 sgRNA CRISPR Lentivector set (Human)

K0601801 3 x 1.0 ug
EUR 339

Dhx58 sgRNA CRISPR Lentivector set (Mouse)

K4414301 3 x 1.0 ug
EUR 339

Dhx58 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6062902 1.0 ug DNA
EUR 154

Dhx58 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6062903 1.0 ug DNA
EUR 154

Dhx58 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6062904 1.0 ug DNA
EUR 154

DHX58 sgRNA CRISPR Lentivector (Human) (Target 1)

K0601802 1.0 ug DNA
EUR 154

DHX58 sgRNA CRISPR Lentivector (Human) (Target 2)

K0601803 1.0 ug DNA
EUR 154

DHX58 sgRNA CRISPR Lentivector (Human) (Target 3)

K0601804 1.0 ug DNA
EUR 154

Dhx58 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4414302 1.0 ug DNA
EUR 154

Dhx58 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4414303 1.0 ug DNA
EUR 154

Dhx58 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4414304 1.0 ug DNA
EUR 154

DHX58 Protein Vector (Mouse) (pPB-C-His)

PV172034 500 ng
EUR 1065

DHX58 Protein Vector (Mouse) (pPB-N-His)

PV172035 500 ng
EUR 1065

DHX58 Protein Vector (Mouse) (pPM-C-HA)

PV172036 500 ng
EUR 1065

DHX58 Protein Vector (Mouse) (pPM-C-His)

PV172037 500 ng
EUR 1065

DHX58 Protein Vector (Rat) (pPB-C-His)

PV264058 500 ng
EUR 1166

DHX58 Protein Vector (Rat) (pPB-N-His)

PV264059 500 ng
EUR 1166

DHX58 Protein Vector (Rat) (pPM-C-HA)

PV264060 500 ng
EUR 1166

DHX58 Protein Vector (Rat) (pPM-C-His)

PV264061 500 ng
EUR 1166

DHX58 Protein Vector (Human) (pPB-C-His)

PV012441 500 ng
EUR 329

DHX58 Protein Vector (Human) (pPB-N-His)

PV012442 500 ng
EUR 329

DHX58 Rabbit Polyclonal Antibody

Recent Posts

Categories

January 2022
M T W T F S S
 12
3456789
10111213141516
17181920212223
24252627282930
31  

Pages