Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG

fallback-image

SGCD Rabbit Polyclonal Antibody

SGCD Rabbit Polyclonal Antibody

Contact us: [email protected]

SGCD Polyclonal Antibody
ABP60383-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human SGCD protein
  • Applications tips:
Description: A polyclonal antibody for detection of SGCD from Human, Mouse. This SGCD antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SGCD protein
SGCD Polyclonal Antibody
ABP60383-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human SGCD protein
  • Applications tips:
Description: A polyclonal antibody for detection of SGCD from Human, Mouse. This SGCD antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SGCD protein
SGCD Polyclonal Antibody
ES11141-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against SGCD from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
SGCD Polyclonal Antibody
ES11141-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against SGCD from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
Human Sarcoglycan Delta (SGCd) ELISA Kit
DLR-SGCd-Hu-48T 48T
EUR 517
  • Should the Human Sarcoglycan Delta (SGCd) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Sarcoglycan Delta (SGCd) in samples from tissue homogenates or other biological fluids.
Human Sarcoglycan Delta (SGCd) ELISA Kit
DLR-SGCd-Hu-96T 96T
EUR 673
  • Should the Human Sarcoglycan Delta (SGCd) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Sarcoglycan Delta (SGCd) in samples from tissue homogenates or other biological fluids.
Human Sarcoglycan Delta (SGCd) ELISA Kit
RD-SGCd-Hu-48Tests 48 Tests
EUR 521
Human Sarcoglycan Delta (SGCd) ELISA Kit
RD-SGCd-Hu-96Tests 96 Tests
EUR 723
Human Sarcoglycan Delta (SGCd) ELISA Kit
RDR-SGCd-Hu-48Tests 48 Tests
EUR 544
Human Sarcoglycan Delta (SGCd) ELISA Kit
RDR-SGCd-Hu-96Tests 96 Tests
EUR 756
SGCD Rabbit pAb
A13351-100ul 100 ul
EUR 308
SGCD Rabbit pAb
A13351-200ul 200 ul
EUR 459
SGCD Rabbit pAb
A13351-20ul 20 ul
EUR 183
SGCD Rabbit pAb
A13351-50ul 50 ul
EUR 223
SGCD Rabbit pAb
A6980-100ul 100 ul
EUR 308
SGCD Rabbit pAb
A6980-200ul 200 ul
EUR 459
SGCD Rabbit pAb
A6980-20ul 20 ul
EUR 183
SGCD Rabbit pAb
A6980-50ul 50 ul
EUR 223
SGCD Antibody
47201-100ul 100ul
EUR 252
SGCD antibody
10R-10249 50 ul
EUR 219
Description: Mouse monoclonal SGCD antibody
SGCD Antibody
1-CSB-PA835688ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SGCD. Recognizes SGCD from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200
Polyclonal Sgcd antibody - N-terminal region
APR00916G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Sgcd - N-terminal region. This antibody is tested and proven to work in the following applications:
Polyclonal SGCD / Delta-Sarcoglycan Antibody (Internal)
APG01191G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human SGCD / Delta-Sarcoglycan (Internal). This antibody is tested and proven to work in the following applications:
Sarcoglycan Delta (SGCd) Polyclonal Antibody (Human)
4-PAE226Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SGCd (Ile63~Leu289)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sarcoglycan Delta (SGCd)
SGCD Conjugated Antibody
C47201 100ul
EUR 397
Anti-SGCD antibody
STJ29060 100 µl
EUR 277
Description: The protein encoded by this gene is one of the four known components of the sarcoglycan complex, which is a subcomplex of the dystrophin-glycoprotein complex (DGC). DGC forms a link between the F-actin cytoskeleton and the extracellular matrix. This protein is expressed most abundantly in skeletal and cardiac muscle. Mutations in this gene have been associated with autosomal recessive limb-girdle muscular dystrophy and dilated cardiomyopathy. Alternatively spliced transcript variants encoding distinct isoforms have been observed for this gene.
Anti-SGCD antibody
STJ115314 100 µl
EUR 277
Description: The protein encoded by this gene is one of the four known components of the sarcoglycan complex, which is a subcomplex of the dystrophin-glycoprotein complex (DGC). DGC forms a link between the F-actin cytoskeleton and the extracellular matrix. This protein is expressed most abundantly in skeletal and cardiac muscle. Mutations in this gene have been associated with autosomal recessive limb-girdle muscular dystrophy and dilated cardiomyopathy. Alternatively spliced transcript variants encoding distinct isoforms have been observed for this gene.
Anti-SGCD antibody
STJ192299 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SGCD
SGCD siRNA
20-abx933150
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SGCD siRNA
20-abx933151
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
Sarcoglycan Delta (SGCd) Polyclonal Antibody (Human), APC
4-PAE226Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SGCd (Ile63~Leu289)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sarcoglycan Delta (SGCd). This antibody is labeled with APC.
Sarcoglycan Delta (SGCd) Polyclonal Antibody (Human), Biotinylated
4-PAE226Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SGCd (Ile63~Leu289)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sarcoglycan Delta (SGCd). This antibody is labeled with Biotin.
Sarcoglycan Delta (SGCd) Polyclonal Antibody (Human), Cy3
4-PAE226Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SGCd (Ile63~Leu289)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sarcoglycan Delta (SGCd). This antibody is labeled with Cy3.
Sarcoglycan Delta (SGCd) Polyclonal Antibody (Human), FITC
4-PAE226Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SGCd (Ile63~Leu289)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sarcoglycan Delta (SGCd). This antibody is labeled with FITC.
Sarcoglycan Delta (SGCd) Polyclonal Antibody (Human), HRP
4-PAE226Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SGCd (Ile63~Leu289)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sarcoglycan Delta (SGCd). This antibody is labeled with HRP.
Sarcoglycan Delta (SGCd) Polyclonal Antibody (Human), PE
4-PAE226Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SGCd (Ile63~Leu289)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sarcoglycan Delta (SGCd). This antibody is labeled with PE.
Sarcoglycan Delta (SGCD) Antibody
20-abx005293
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Sarcoglycan Delta (SGCd) Antibody
20-abx130531
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Sarcoglycan Delta (SGCd) Antibody
20-abx174456
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Sarcoglycan Delta (SGCD) Antibody
20-abx322415
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Sarcoglycan Delta (SGCd) Polyclonal Antibody (Human), APC-Cy7
4-PAE226Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SGCd (Ile63~Leu289)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sarcoglycan Delta (SGCd). This antibody is labeled with APC-Cy7.
Rabbit Anti-Human SGCD monoclonal antibody, clone KN72-21
DCABH-3338 100 ul
EUR 777
SGCD cloning plasmid
CSB-CL835688HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 873
  • Sequence: atgatgcctcaggagcagtacactcaccaccggagcaccatgcctggctctgtggggccacaggtatacaaggtggggatttacggctggcggaaacgatgcctgtatttctttgtcctgctcctcatgattttaatactggtgaacttggccatgaccatctggattctcaaagt
  • Show more
Description: A cloning plasmid for the SGCD gene.
SGCD protein (His tag)
80R-2684 100 ug
EUR 322
Description: Purified recombinant SGCD protein (His tag)
Sarcoglycan Delta (SGCD) Protein
20-abx261024
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.
Mouse SGCD shRNA Plasmid
20-abx973616
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human SGCD shRNA Plasmid
20-abx954355
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Recombinant Sarcoglycan Delta (SGCd)
4-RPE226Hu01
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q92629
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 28.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Sarcoglycan Delta expressed in: E.coli
SGCD Recombinant Protein (Human)
RP028375 100 ug Ask for price
SGCD Recombinant Protein (Rat)
RP228443 100 ug Ask for price
SGCD Recombinant Protein (Rat)
RP228446 100 ug Ask for price
SGCD Recombinant Protein (Mouse)
RP171443 100 ug Ask for price
Human Sarcoglycan Delta (SGCd) Protein
20-abx650584
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Sgcd ORF Vector (Rat) (pORF)
ORF076149 1.0 ug DNA
EUR 506
Sgcd ORF Vector (Rat) (pORF)
ORF076150 1.0 ug DNA
EUR 506
SGCD ORF Vector (Human) (pORF)
ORF009459 1.0 ug DNA
EUR 95
Sgcd ORF Vector (Mouse) (pORF)
ORF057149 1.0 ug DNA
EUR 506
SGCD ELISA Kit (Human) (OKCD01259)
OKCD01259 96 Wells
EUR 831
Description: Description of target: Component of the sarcoglycan complex, a subcomplex of the dystrophin-glycoprotein complex which forms a link between the F-actin cytoskeleton and the extracellular matrix. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.28 ng/mL
Human Sarcoglycan delta (SGCd) ELISA Kit
20-abx153016
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Mouse Delta- sarcoglycan, Sgcd ELISA KIT
ELI-18647m 96 Tests
EUR 865
Human Sarcoglycan delta (SGCd) CLIA Kit
20-abx494548
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Human Delta- sarcoglycan, SGCD ELISA KIT
ELI-36009h 96 Tests
EUR 824

SGCD Rabbit Polyclonal Antibody

Recent Posts

Categories

January 2022
M T W T F S S
 12
3456789
10111213141516
17181920212223
24252627282930
31  

Pages