SOX15 Rabbit Polyclonal Antibody
Contact us: [email protected]
 SOX15 Polyclonal Antibody |
|
ABP60471-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human SOX15 protein at amino acid sequence of 30-110
- Applications tips:
|
|
Description: A polyclonal antibody for detection of SOX15 from Human, Mouse. This SOX15 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SOX15 protein at amino acid sequence of 30-110 |
SOX15 Polyclonal Antibody |
|
ES11211-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against SOX15 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
SOX15 Polyclonal Antibody |
|
ES11211-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against SOX15 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
 SOX15 Rabbit pAb |
|
A18385-100ul |
Abclonal |
100 ul |
EUR 308 |
SOX15 Rabbit pAb |
|
A18385-200ul |
Abclonal |
200 ul |
EUR 459 |
SOX15 Rabbit pAb |
|
A18385-20ul |
Abclonal |
20 ul |
EUR 183 |
SOX15 Rabbit pAb |
|
A18385-50ul |
Abclonal |
50 ul |
EUR 223 |
 Anti-SOX15 Antibody |
|
A07722-1 |
BosterBio |
100ug/vial |
EUR 334 |
 anti- SOX15 antibody |
|
FNab08123 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: SRY(sex determining region Y)-box 15
- Uniprot ID: O60248
- Gene ID: 6665
- Research Area: Epigenetics, Stem Cells, Metabolism
|
|
Description: Antibody raised against SOX15 |
 Anti-SOX15 antibody |
|
STJ192369 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to SOX15 |
 SOX15 siRNA |
|
20-abx934718 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SOX15 siRNA |
|
20-abx934719 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-SOX15 |
|
YF-PA24753 |
Abfrontier |
50 ul |
EUR 334 |
|
Description: Mouse polyclonal to SOX15 |
 SOX15 cloning plasmid |
|
CSB-CL022423HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 702
- Sequence: atggcgctaccaggctcctcacaggaccaggcctggagcctggagcctccggctgccacggctgctgcctcctcatcttcgggaccccaggagcgggagggcgctgggagccccgcggcccccgggacgctgcccctggagaaggtgaagcggccgatgaacgcgttcatggtgtg
- Show more
|
|
Description: A cloning plasmid for the SOX15 gene. |
) Anti-SOX15 (2C1) |
|
YF-MA10868 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to SOX15 |
) Anti-SOX15 (1B3) |
|
YF-MA15533 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to SOX15 |
 Mouse SOX15 shRNA Plasmid |
|
20-abx972829 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human SOX15 shRNA Plasmid |
|
20-abx954544 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) SOX15 Recombinant Protein (Rat) |
|
RP230525 |
ABM |
100 ug |
Ask for price |
) SOX15 Recombinant Protein (Human) |
|
RP029716 |
ABM |
100 ug |
Ask for price |
) SOX15 Recombinant Protein (Mouse) |
|
RP174575 |
ABM |
100 ug |
Ask for price |
 (pORF)) Sox15 ORF Vector (Rat) (pORF) |
|
ORF076843 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) SOX15 ORF Vector (Human) (pORF) |
|
ORF009906 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Sox15 ORF Vector (Mouse) (pORF) |
|
ORF058193 |
ABM |
1.0 ug DNA |
EUR 506 |
) Sox15 sgRNA CRISPR Lentivector set (Rat) |
|
K6163301 |
ABM |
3 x 1.0 ug |
EUR 339 |
) SOX15 sgRNA CRISPR Lentivector set (Human) |
|
K2261401 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Sox15 sgRNA CRISPR Lentivector set (Mouse) |
|
K4695501 |
ABM |
3 x 1.0 ug |
EUR 339 |
 Antibody) Sex Determining Region Y Box Protein 15 (SOX15) Antibody |
|
abx026837-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Sex Determining Region Y Box Protein 15 (SOX15) Antibody |
|
abx026837-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Sex Determining Region Y Box Protein 15 (SOX15) Antibody |
|
abx238123-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Sex Determining Region Y Box Protein 15 (SOX15) Antibody |
|
abx433305-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
 (Target 1)) Sox15 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6163302 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Sox15 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6163303 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Sox15 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6163304 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) SOX15 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K2261402 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) SOX15 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K2261403 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) SOX15 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K2261404 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Sox15 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K4695502 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Sox15 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K4695503 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Sox15 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K4695504 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) SOX15 Protein Vector (Rat) (pPB-C-His) |
|
PV307370 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) SOX15 Protein Vector (Rat) (pPB-N-His) |
|
PV307371 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) SOX15 Protein Vector (Rat) (pPM-C-HA) |
|
PV307372 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) SOX15 Protein Vector (Rat) (pPM-C-His) |
|
PV307373 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) SOX15 Protein Vector (Human) (pPB-C-His) |
|
PV039621 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) SOX15 Protein Vector (Human) (pPB-N-His) |
|
PV039622 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) SOX15 Protein Vector (Human) (pPM-C-HA) |
|
PV039623 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) SOX15 Protein Vector (Human) (pPM-C-His) |
|
PV039624 |
ABM |
500 ng |
EUR 329 |
 (pPB-C-His)) SOX15 Protein Vector (Mouse) (pPB-C-His) |
|
PV232770 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) SOX15 Protein Vector (Mouse) (pPB-N-His) |
|
PV232771 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) SOX15 Protein Vector (Mouse) (pPM-C-HA) |
|
PV232772 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) SOX15 Protein Vector (Mouse) (pPM-C-His) |
|
PV232773 |
ABM |
500 ng |
EUR 603 |
 Sox15 3'UTR Luciferase Stable Cell Line |
|
TU119483 |
ABM |
1.0 ml |
Ask for price |
 Sox15 3'UTR GFP Stable Cell Line |
|
TU169483 |
ABM |
1.0 ml |
Ask for price |
Sox15 3'UTR Luciferase Stable Cell Line |
|
TU220987 |
ABM |
1.0 ml |
Ask for price |
Sox15 3'UTR GFP Stable Cell Line |
|
TU270987 |
ABM |
1.0 ml |
Ask for price |
 SOX15 3'UTR GFP Stable Cell Line |
|
TU074347 |
ABM |
1.0 ml |
EUR 1394 |
 SOX15 3'UTR Luciferase Stable Cell Line |
|
TU024347 |
ABM |
1.0 ml |
EUR 1394 |
 GAPDH Rabbit Polyclonal Antibody |
|
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
|
37985-50ul |
SAB |
50ul |
EUR 187 |
 EFHD1 Rabbit Polyclonal Antibody |
|
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
|
38001-50ul |
SAB |
50ul |
EUR 187 |
 Alliinase Rabbit Polyclonal Antibody |
|
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
|
38042-50ul |
SAB |
50ul |
EUR 187 |
 ECFP Rabbit Polyclonal Antibody |
|
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
|
38077-50ul |
SAB |
50ul |
EUR 187 |
 EYFP Rabbit Polyclonal Antibody |
|
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
|
38078-50ul |
SAB |
50ul |
EUR 187 |
 mOrange Rabbit Polyclonal Antibody |
|
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
|
38079-50ul |
SAB |
50ul |
EUR 187 |
 mStrawberry Rabbit Polyclonal Antibody |
|
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
|
38083-50ul |
SAB |
50ul |
EUR 187 |
 AmCyan Rabbit Polyclonal Antibody |
|
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
|
38086-50ul |
SAB |
50ul |
EUR 187 |
 EBFP Rabbit Polyclonal Antibody |
|
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
|
38087-50ul |
SAB |
50ul |
EUR 187 |
 Vimentin Rabbit Polyclonal Antibody |
|
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
|
38104-50ul |
SAB |
50ul |
EUR 187 |
 LDHD Rabbit Polyclonal Antibody |
|
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
|
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
 Rabbit Hemoglobin Polyclonal Antibody |
|
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 Met Rabbit Polyclonal Antibody |
|
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
 VEGF Rabbit Polyclonal Antibody |
|
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
SOX15 Rabbit Polyclonal Antibody
