Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG


FAM3C Rabbit Polyclonal Antibody

FAM3C Rabbit Polyclonal Antibody

Contact us: [email protected]

FAM3C Polyclonal Antibody

ABP58526-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human FAM3C protein
  • Applications tips:
Description: A polyclonal antibody for detection of FAM3C from Human, Mouse, Rat. This FAM3C antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FAM3C protein

FAM3C Polyclonal Antibody

ABP58526-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human FAM3C protein
  • Applications tips:
Description: A polyclonal antibody for detection of FAM3C from Human, Mouse, Rat. This FAM3C antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FAM3C protein

FAM3C Polyclonal Antibody

ES10951-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against FAM3C from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

FAM3C Polyclonal Antibody

ES10951-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against FAM3C from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

FAM3C Rabbit pAb

A18274-100ul 100 ul
EUR 308

FAM3C Rabbit pAb

A18274-200ul 200 ul
EUR 459

FAM3C Rabbit pAb

A18274-20ul 20 ul
EUR 183

FAM3C Rabbit pAb

A18274-50ul 50 ul
EUR 223

FAM3C Polyclonal Conjugated Antibody

C30389 100ul
EUR 397

FAM3C antibody

70R-17220 50 ul
EUR 435
Description: Rabbit polyclonal FAM3C antibody

FAM3C Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FAM3C. Recognizes FAM3C from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

FAM3C Antibody

DF12605 200ul
EUR 304
Description: FAM3C Antibody detects endogenous levels of FAM3C.

FAM3C antibody

70R-6730 50 ug
EUR 467
Description: Rabbit polyclonal FAM3C antibody raised against the C terminal of FAM3C

FAM3C Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against FAM3C. Recognizes FAM3C from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

FAM3C Polyclonal Antibody, HRP Conjugated

A67079 100 µg
EUR 570.55
Description: reagents widely cited

FAM3C Polyclonal Antibody, FITC Conjugated

A67080 100 µg
EUR 570.55
Description: Ask the seller for details

FAM3C Polyclonal Antibody, Biotin Conjugated

A67081 100 µg
EUR 570.55
Description: The best epigenetics products

Polyclonal ILEI / FAM3C Antibody (aa40-80)

APR02436G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ILEI / FAM3C (aa40-80). This antibody is tested and proven to work in the following applications:

anti- FAM3C antibody

FNab02981 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:20-1:200
  • Immunogen: family with sequence similarity 3, member C
  • Uniprot ID: Q92520
  • Gene ID: 10447
  • Research Area: Cell Division and Proliferation, Signal Transduction
Description: Antibody raised against FAM3C

anti- FAM3C antibody

FNab02982 100µg
EUR 585
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:50-1:500
  • IF: 1:50-1:500
  • Immunogen: family with sequence similarity 3, member C
  • Uniprot ID: Q92520
  • Gene ID: 10447
  • Research Area: Cell Division and Proliferation, Signal Transduction
Description: Antibody raised against FAM3C

Anti-FAM3C antibody

PAab02981 100 ug
EUR 386

Anti-FAM3C antibody

STJ11100230 100 µl
EUR 277
Description: This gene is a member of the family with sequence similarity 3 (FAM3) family and encodes a secreted protein with a GG domain. A change in expression of this protein has been noted in pancreatic cancer-derived cells.

Anti-FAM3C antibody

STJ192109 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to FAM3C

Fam3c/ Rat Fam3c ELISA Kit

ELI-27431r 96 Tests
EUR 886

Mouse Protein FAM3C, Fam3c ELISA KIT

ELI-27430m 96 Tests
EUR 865

Human Protein FAM3C(FAM3C) ELISA kit

CSB-EL008228HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Protein FAM3C (FAM3C) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Protein FAM3C(FAM3C) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Protein FAM3C(FAM3C) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse Protein FAM3C(FAM3C) ELISA kit

CSB-EL008228MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Protein FAM3C (FAM3C) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Protein FAM3C(FAM3C) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Protein FAM3C(FAM3C) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Protein FAM3C (FAM3C) ELISA Kit

abx387273-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Protein FAM3C, FAM3C ELISA KIT

ELI-32857h 96 Tests
EUR 824

Bovine Protein FAM3C, FAM3C ELISA KIT

ELI-32966b 96 Tests
EUR 928


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FAM3C Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FAM3C. Recognizes FAM3C from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

FAM3C Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FAM3C. Recognizes FAM3C from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

FAM3C Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FAM3C. Recognizes FAM3C from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

FAM3C Blocking Peptide

33R-2091 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FAM3C antibody, catalog no. 70R-6730

FAM3C Blocking Peptide

DF12605-BP 1mg
EUR 195

FAM3C cloning plasmid

CSB-CL856401HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 684
  • Sequence: atgagggtagcaggtgctgcaaagttggtggtagctgtggcagtgtttttactgacattttatgttatttctcaagtatttgaaataaaaatggatgcaagtttaggaaatctatttgcaagatcagcattggacacagctgcacgttctacaaagcctcccagatataagtgtgg
  • Show more
Description: A cloning plasmid for the FAM3C gene.

Anti-FAM3C (3A3)

YF-MA17308 100 ug
EUR 363
Description: Mouse monoclonal to FAM3C

FAM3C protein (His tag)

80R-2004 50 ug
EUR 424
Description: Recombinant human FAM3C protein (His tag)


EF009533 96 Tests
EUR 689

FAM3C Rabbit Polyclonal Antibody

Recent Posts


January 2022
