Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG


HBEGF Rabbit Polyclonal Antibody

HBEGF Rabbit Polyclonal Antibody

Contact us: [email protected]

HBEGF Polyclonal Antibody
29821-50ul 50ul
EUR 187
HBEGF Polyclonal Antibody
29957-100ul 100ul
EUR 252
HBEGF Polyclonal Antibody
29957-50ul 50ul
EUR 187
HBEGF Polyclonal Antibody
A69147 100 ?g
EUR 628.55
Description: kits suitable for this type of research
HBEGF Polyclonal Antibody
ABP58755-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human HBEGF protein at amino acid sequence of 130-210
  • Applications tips:
Description: A polyclonal antibody for detection of HBEGF from Human, Mouse, Rat. This HBEGF antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HBEGF protein at amino acid sequence of 130-210
HBEGF Polyclonal Antibody
ABP58755-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human HBEGF protein at amino acid sequence of 130-210
  • Applications tips:
Description: A polyclonal antibody for detection of HBEGF from Human, Mouse, Rat. This HBEGF antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HBEGF protein at amino acid sequence of 130-210
HBEGF Polyclonal Antibody
ABP58755-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human HBEGF protein at amino acid sequence of 130-210
  • Applications tips:
Description: A polyclonal antibody for detection of HBEGF from Human, Mouse, Rat. This HBEGF antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HBEGF protein at amino acid sequence of 130-210
HBEGF Polyclonal Antibody
ES11256-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HBEGF from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
HBEGF Polyclonal Antibody
ES11256-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HBEGF from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
HBEGF Rabbit pAb
A16365-100ul 100 ul
EUR 308
HBEGF Rabbit pAb
A16365-200ul 200 ul
EUR 459
HBEGF Rabbit pAb
A16365-20ul 20 ul
EUR 183
HBEGF Rabbit pAb
A16365-50ul 50 ul
EUR 223
HBEGF Rabbit pAb
A1695-100ul 100 ul
EUR 308
HBEGF Rabbit pAb
A1695-200ul 200 ul
EUR 459
HBEGF Rabbit pAb
A1695-20ul 20 ul
EUR 183
HBEGF Rabbit pAb
A1695-50ul 50 ul
EUR 223
Polyclonal HBEGF Antibody (Center)
APR04021G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HBEGF (Center). This antibody is tested and proven to work in the following applications:
HBEGF Polyclonal Conjugated Antibody
C29821 100ul
EUR 397
HBEGF Polyclonal Conjugated Antibody
C29957 100ul
EUR 397
HBEGF Polyclonal Antibody, HRP Conjugated
A69148 100 ?g
EUR 628.55
Description: fast delivery possible
HBEGF Polyclonal Antibody, FITC Conjugated
A69149 100 ?g
EUR 628.55
Description: reagents widely cited
HBEGF Polyclonal Antibody, Biotin Conjugated
A69150 100 ?g
EUR 628.55
Description: Ask the seller for details
HBEGF Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HBEGF. Recognizes HBEGF from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:20-1:200
Human Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit
EUR 388
  • Should the Human Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit
EUR 496
  • Should the Human Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Mouse Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit
EUR 396
  • Should the Mouse Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Mouse Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit
EUR 508
  • Should the Mouse Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Rat Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit
EUR 413
  • Should the Rat Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Rat Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit
EUR 531
  • Should the Rat Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit
RDR-HBEGF-Hu-48Tests 48 Tests
EUR 391
Human Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit
RDR-HBEGF-Hu-96Tests 96 Tests
EUR 538
Mouse Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit
RDR-HBEGF-Mu-48Tests 48 Tests
EUR 402
Mouse Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit
RDR-HBEGF-Mu-96Tests 96 Tests
EUR 552
Rat Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit
RDR-HBEGF-Ra-48Tests 48 Tests
EUR 422
Rat Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit
RDR-HBEGF-Ra-96Tests 96 Tests
EUR 581
Human Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit
RD-HBEGF-Hu-48Tests 48 Tests
EUR 375
Human Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit
RD-HBEGF-Hu-96Tests 96 Tests
EUR 515
Mouse Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit
RD-HBEGF-Mu-48Tests 48 Tests
EUR 385
Mouse Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit
RD-HBEGF-Mu-96Tests 96 Tests
EUR 528
Rat Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit
RD-HBEGF-Ra-48Tests 48 Tests
EUR 404
Rat Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit
RD-HBEGF-Ra-96Tests 96 Tests
EUR 556
Anti-HBEGF antibody
STJ27528 100 µl
EUR 277
Anti-HBEGF antibody
STJ118805 100 µl
EUR 277
Anti-HBEGF antibody
STJ192414 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to HBEGF
HBEGF Protein
  • EUR 230.00
  • EUR 1970.00
  • EUR 328.00
  • 10 ug
  • 1 mg
  • 50 ug
  • Shipped within 5-10 working days.
HBEGF Protein
  • EUR 328.00
  • EUR 4448.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.
HBEGF Protein
  • EUR 230.00
  • EUR 1790.00
  • EUR 328.00
  • 10 ug
  • 1 mg
  • 50 ug
  • Shipped within 5-10 working days.
HBEGF Protein
  • EUR 230.00
  • EUR 1790.00
  • EUR 328.00
  • 10 ug
  • 1 mg
  • 50 ug
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
HBEGF Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HBEGF. Recognizes HBEGF from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
HBEGF Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HBEGF. Recognizes HBEGF from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
HBEGF Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HBEGF. Recognizes HBEGF from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
HBEGF cloning plasmid
CSB-CL857429HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 627
  • Sequence: atgaagctgctgccgtcggtggtgctgaagctctttctggctgcagttctctcggcactggtgactggcgagagcctggagcggcttcggagagggctagctgctggaaccagcaacccggaccctcccactgtatccacggaccagctgctacccctaggaggcggccgggaccg
  • Show more
Description: A cloning plasmid for the HBEGF gene.
HBEGF protein (His tag)
80R-2915 50 ug
EUR 327
Description: Purified recombinant HBEGF protein (His tag)
HBEGF protein (His tag)
80R-3462 50 ug
EUR 257
Description: Purified recombinant HBEGF protein (His tag)
ELA-E1479h 96 Tests
EUR 824
Anserini HBEGF ELISA Kit
EAH0045 96Tests
EUR 521
EF000129 96 Tests
EUR 689
ELI-04850c 96 Tests
EUR 928
Rat HBEGF shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human HBEGF shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse HBEGF shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
LF-EK50781 1×96T
EUR 648
Rabbit heparin binding EGF like growth factor (HBEGF) ELISA kit
E04H1364-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit heparin binding EGF like growth factor (HBEGF) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit heparin binding EGF like growth factor (HBEGF) ELISA kit
E04H1364-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit heparin binding EGF like growth factor (HBEGF) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit heparin binding EGF like growth factor (HBEGF) ELISA kit
E04H1364-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit heparin binding EGF like growth factor (HBEGF) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
HBEGF protein (Mouse) (His tag)
80R-3461 50 ug
EUR 257
Description: Purified recombinant HBEGF protein (Mouse) (His tag)
ELISA kit for Human HBEGF
EK5330 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human HBEGF in samples from serum, plasma, tissue homogenates and other biological fluids.
Human HBEGF PicoKine ELISA Kit
EK0770 96 wells
EUR 425
Description: For quantitative detection of human HBEGF in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).
Hbegf ORF Vector (Rat) (pORF)
ORF068089 1.0 ug DNA
EUR 506
h HBEGF inducible lentiviral particles
LVP721 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made over-expression lentivirus for expressing human target: h HBEGF (heparin-binding EGF-like growth factor), [alternative names: DTR; DTS; DTSF; HEGFL]. The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_001945. It also contains a RFP-Blasticidin dual selection marker.
HBEGF ORF Vector (Human) (pORF)
ORF004813 1.0 ug DNA
EUR 95
Hbegf ORF Vector (Mouse) (pORF)
ORF047006 1.0 ug DNA
EUR 506
HBEGF ELISA Kit (Human) (OKAN04671)
OKAN04671 96 Wells
EUR 792
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.4 pg/mL
HBEGF ELISA Kit (Mouse) (OKAN06622)
OKAN06622 96 Wells
EUR 792
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.1 pg/mL
HBEGF ELISA Kit (Human) (OKBB00436)
OKBB00436 96 Wells
EUR 505
Description: Description of target: HBEGF (Heparin-binding EGF-like growth factor), also known as HEGFL or DTR, is a member of the EGF family of proteins that in humans is encoded by the HBEGF gene. The HBEGF gene is assigned to chromosome 5, thus confirming the assignment of the gene on the basis of its role in relation to diphtheria toxin susceptibility. HB-EGF is an 87 amino acid glycoprotein which displays highly regulated gene expression. It has been shown to play a role in wound healing, cardiac hypertrophy and heart development and function. HB-EGF binding and activation of EGF receptors plays a critical role during cardiac valve tissue development and the maintenance of normal heart function in adults. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 10 pg/mL
HBEGF ELISA Kit (Human) (OKCD07421)
OKCD07421 96 Wells
EUR 792
Description: Description of target: HBEGF is a growth factor that mediates its effects via EGFR, ERBB2 and ERBB4. It is required for normal cardiac valve formation and normal heart function. HBEGF promotes smooth muscle cell proliferation. It may be involved in macrophage-mediated cellular proliferation. It is mitogenic for fibroblasts, but not endothelial cells. It is able to bind EGF receptor/EGFR with higher affinity than EGF itself and is a far more potent mitogen for smooth muscle cells than EGF. It also acts as a diphtheria toxin receptor.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 6.4pg/mL
HBEGF ELISA Kit (Mouse) (OKCD07422)
OKCD07422 96 Wells
EUR 701
Description: Description of target: Growth factor that mediates its effects via EGFR, ERBB2 and ERBB4. Required for normal cardiac valve formation and normal heart function. Promotes smooth muscle cell proliferation. May be involved in macrophage-mediated cellular proliferation. It is mitogenic for fibroblasts, but not endothelial cells. It is able to bind EGF receptor/EGFR with higher affinity than EGF itself and is a far more potent mitogen for smooth muscle cells than EGF. Also acts as a diphtheria toxin receptor.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 6.1pg/mL
HBEGF ELISA Kit (Rat) (OKCD07423)
OKCD07423 96 Wells
EUR 727
Description: Description of target: activates epidermal growth factor receptor mediated signaling; contributes to neuronal survival; may play a role in neurogenesis during ventral midbrain development.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 6.1pg/mL
HBEGF ELISA Kit (Pig) (OKEH01049)
OKEH01049 96 Wells
EUR 779
Description: Description of target: ;Species reactivity: Pig;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 7.4 pg/mL
HBEGF ELISA Kit (Rat) (OKEH06415)
OKEH06415 96 Wells
EUR 662
Description: Description of target: Growth factor that mediates its effects via EGFR, ERBB2 and ERBB4. Required for normal cardiac valve formation and normal heart function. Promotes smooth muscle cell proliferation. May be involved in macrophage-mediated cellular proliferation. It is mitogenic for fibroblasts, but not endothelial cells. It is able to bind EGF receptor/EGFR with higher affinity than EGF itself and is a far more potent mitogen for smooth muscle cells than EGF. Also acts as a diphtheria toxin receptor.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.6 pg/mL
HBEGF ELISA Kit (Mouse) (OKEH04470)
OKEH04470 96 Wells
EUR 662
Description: Description of target: Growth factor that mediates its effects via EGFR, ERBB2 and ERBB4. Required for normal cardiac valve formation and normal heart function. Promotes smooth muscle cell proliferation. May be involved in macrophage-mediated cellular proliferation. It is mitogenic for fibroblasts, but not endothelial cells. It is able to bind EGF receptor/EGFR with higher affinity than EGF itself and is a far more potent mitogen for smooth muscle cells than EGF. Also acts as a diphtheria toxin receptor.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 8.01 pg/mL
Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) Polyclonal Antibody (Human)
  • EUR 217.00
  • EUR 2048.00
  • EUR 520.00
  • EUR 268.00
  • EUR 201.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBEGF (Val21~Thr160)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF)
Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) Polyclonal Antibody (Mouse)
  • EUR 221.00
  • EUR 2100.00
  • EUR 532.00
  • EUR 272.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBEGF (Ser25~Thr160)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF)
Proheparin-Binding EGF-Like Growth Factor (HBEGF) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Proheparin-Binding EGF-Like Growth Factor (HBEGF) Antibody
abx028334-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Proheparin-Binding EGF-Like Growth Factor (HBEGF) Antibody
abx028334-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Heparin Binding EGF Like Growth Factor (HBEGF) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) Polyclonal Antibody (Human), APC
  • EUR 301.00
  • EUR 2645.00
  • EUR 755.00
  • EUR 377.00
  • EUR 200.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBEGF (Val21~Thr160)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF). This antibody is labeled with APC.
Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) Polyclonal Antibody (Human), Biotinylated
  • EUR 279.00
  • EUR 1998.00
  • EUR 612.00
  • EUR 334.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBEGF (Val21~Thr160)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF). This antibody is labeled with Biotin.
Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) Polyclonal Antibody (Human), Cy3
  • EUR 360.00
  • EUR 3485.00
  • EUR 965.00
  • EUR 461.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBEGF (Val21~Thr160)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF). This antibody is labeled with Cy3.
Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) Polyclonal Antibody (Human), FITC
  • EUR 261.00
  • EUR 2136.00
  • EUR 624.00
  • EUR 321.00
  • EUR 180.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBEGF (Val21~Thr160)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF). This antibody is labeled with FITC.
Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) Polyclonal Antibody (Human), HRP
  • EUR 277.00
  • EUR 2309.00
  • EUR 671.00
  • EUR 343.00
  • EUR 190.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBEGF (Val21~Thr160)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF). This antibody is labeled with HRP.
Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) Polyclonal Antibody (Human), PE
  • EUR 261.00
  • EUR 2136.00
  • EUR 624.00
  • EUR 321.00
  • EUR 180.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBEGF (Val21~Thr160)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF). This antibody is labeled with PE.
Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) Polyclonal Antibody (Mouse), APC
  • EUR 306.00
  • EUR 2717.00
  • EUR 773.00
  • EUR 384.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBEGF (Ser25~Thr160)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF). This antibody is labeled with APC.
Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) Polyclonal Antibody (Mouse), Biotinylated
  • EUR 283.00
  • EUR 2050.00
  • EUR 625.00
  • EUR 340.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBEGF (Ser25~Thr160)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF). This antibody is labeled with Biotin.

HBEGF Rabbit Polyclonal Antibody

Recent Posts


January 2022
