Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG

fallback-image

NR4A2 Rabbit Polyclonal Antibody

NR4A2 Rabbit Polyclonal Antibody

Contact us: [email protected]

NR4A2 Polyclonal Antibody
ABP59528-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human NR4A2 protein at amino acid sequence of 100-180
  • Applications tips:
Description: A polyclonal antibody for detection of NR4A2 from Human, Mouse, Rat. This NR4A2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NR4A2 protein at amino acid sequence of 100-180
NR4A2 Polyclonal Antibody
ABP59528-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human NR4A2 protein at amino acid sequence of 100-180
  • Applications tips:
Description: A polyclonal antibody for detection of NR4A2 from Human, Mouse, Rat. This NR4A2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NR4A2 protein at amino acid sequence of 100-180
NR4A2 Polyclonal Antibody
ES11283-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NR4A2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
NR4A2 Polyclonal Antibody
ES11283-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NR4A2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
NR4A2 Rabbit pAb
A17318-100ul 100 ul
EUR 308
NR4A2 Rabbit pAb
A17318-200ul 200 ul
EUR 459
NR4A2 Rabbit pAb
A17318-20ul 20 ul
EUR 183
NR4A2 Rabbit pAb
A17318-50ul 50 ul
EUR 223
Polyclonal NR4A2 Antibody (Center)
APR08823G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NR4A2 (Center). This antibody is tested and proven to work in the following applications:
NR4A2 antibody
70R-18956 50 ul
EUR 435
Description: Rabbit polyclonal NR4A2 antibody
NR4A2 Antibody
35847-100ul 100ul
EUR 252
NR4A2 antibody
10R-1497 50 ug
EUR 242
Description: Mouse monoclonal NR4A2 antibody
NR4A2 Antibody
1-CSB-PA949280
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NR4A2. Recognizes NR4A2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100
NR4A2 Antibody
1-CSB-PA449475
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NR4A2. Recognizes NR4A2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200
NR4A2 Antibody
1-CSB-PA016063GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against NR4A2. Recognizes NR4A2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC
Polyclonal NURR1 (NR4A2) Antibody (N-term)
APR10842G 0.1ml
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NURR1 (NR4A2) (N-term). This antibody is tested and proven to work in the following applications:
Polyclonal NR4A2 antibody - C-terminal region
APR08828G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NR4A2 - C-terminal region. This antibody is tested and proven to work in the following applications:
Nr4a2/ Rat Nr4a2 ELISA Kit
ELI-36911r 96 Tests
EUR 886
Nurr1/NR4A2 Antibody
DF12678 200ul
EUR 304
Description: Nurr1/NR4A2 Antibody detects endogenous levels of Nurr1/NR4A2.
NR4A2 Conjugated Antibody
C35847 100ul
EUR 397
Anti-NR4A2 antibody
STJ119448 100 µl
EUR 277
Description: This gene encodes a member of the steroid-thyroid hormone-retinoid receptor superfamily. The encoded protein may act as a transcription factor. Mutations in this gene have been associated with disorders related to dopaminergic dysfunction, including Parkinson disease, schizophernia, and manic depression. Misregulation of this gene may be associated with rheumatoid arthritis. Alternatively spliced transcript variants have been described, but their biological validity has not been determined.
Anti-NR4A2 Antibody
STJ501990 100 µg
EUR 476
Anti-NR4A2 antibody
STJ192441 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NR4A2
NR4A2 siRNA
20-abx903651
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
NR4A2 siRNA
20-abx926353
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
NR4A2 siRNA
20-abx926354
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti- Nurr1/NR4A2 antibody
FNab05936 100µg
EUR 585
  • Immunogen: nuclear receptor subfamily 4, group A, member 2
  • Uniprot ID: P43354
  • Research Area: Neuroscience, Signal Transduction, Metabolism, Developmental biology
Description: Antibody raised against Nurr1/NR4A2
Anti-Nurr1/NR4A2 antibody
PAab05936 100 ug
EUR 412
Anti-Nurr1/NR4A2 Antibody
PB9297 100ug/vial
EUR 294
Anti-NR4A2 Antibody (Biotin)
STJ501991 100 µg
EUR 586
Anti-NR4A2 Antibody (FITC)
STJ501992 100 µg
EUR 586
NR4A2 cloning plasmid
CSB-CL016063HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1797
  • Sequence: atgccttgtgttcaggcgcagtatgggtcctcgcctcaaggagccagccccgcttctcagagctacagttaccactcttcgggagaatacagctccgatttcttaactccagagtttgtcaagtttagcatggacctcaccaacactgaaatcactgccaccacttctctcccca
  • Show more
Description: A cloning plasmid for the NR4A2 gene.
Anti-NR4A2 (4A6)
YF-MA20377 200 ul
EUR 363
Description: Mouse monoclonal to NR4A2

NR4A2 Rabbit Polyclonal Antibody

Recent Posts

Categories

January 2022
M T W T F S S
 12
3456789
10111213141516
17181920212223
24252627282930
31  

Pages