NR4A2 Rabbit Polyclonal Antibody

Contact us: [email protected]

NR4A2 Polyclonal Antibody
ABP59528-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human NR4A2 protein at amino acid sequence of 100-180 Applications tips:
Description: A polyclonal antibody for detection of NR4A2 from Human, Mouse, Rat. This NR4A2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NR4A2 protein at amino acid sequence of 100-180

NR4A2 Polyclonal Antibody
ABP59528-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human NR4A2 protein at amino acid sequence of 100-180 Applications tips:
Description: A polyclonal antibody for detection of NR4A2 from Human, Mouse, Rat. This NR4A2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NR4A2 protein at amino acid sequence of 100-180

NR4A2 Polyclonal Antibody
ES11283-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NR4A2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

NR4A2 Polyclonal Antibody
ES11283-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NR4A2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

NR4A2 Rabbit pAb
A17318-100ul	Abclonal	100 ul	EUR 308

NR4A2 Rabbit pAb
A17318-200ul	Abclonal	200 ul	EUR 459

NR4A2 Rabbit pAb
A17318-20ul	Abclonal	20 ul	EUR 183

NR4A2 Rabbit pAb
A17318-50ul	Abclonal	50 ul	EUR 223

Polyclonal NR4A2 Antibody (Center)
APR08823G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NR4A2 (Center). This antibody is tested and proven to work in the following applications:

NR4A2 antibody
70R-18956	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal NR4A2 antibody

NR4A2 Antibody
35847-100ul	SAB	100ul	EUR 252

NR4A2 antibody
10R-1497	Fitzgerald	50 ug	EUR 242
Description: Mouse monoclonal NR4A2 antibody

NR4A2 Antibody
1-CSB-PA949280	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NR4A2. Recognizes NR4A2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

NR4A2 Antibody
1-CSB-PA449475	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NR4A2. Recognizes NR4A2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

NR4A2 Antibody
1-CSB-PA016063GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against NR4A2. Recognizes NR4A2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

Polyclonal NURR1 (NR4A2) Antibody (N-term)
APR10842G	Leading Biology	0.1ml	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NURR1 (NR4A2) (N-term). This antibody is tested and proven to work in the following applications:

Polyclonal NR4A2 antibody - C-terminal region
APR08828G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NR4A2 - C-terminal region. This antibody is tested and proven to work in the following applications:

Nr4a2/ Rat Nr4a2 ELISA Kit
ELI-36911r	Lifescience Market	96 Tests	EUR 886

Nurr1/NR4A2 Antibody
DF12678	Affbiotech	200ul	EUR 304
Description: Nurr1/NR4A2 Antibody detects endogenous levels of Nurr1/NR4A2.

NR4A2 Conjugated Antibody
C35847	SAB	100ul	EUR 397

Anti-NR4A2 antibody
STJ119448	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the steroid-thyroid hormone-retinoid receptor superfamily. The encoded protein may act as a transcription factor. Mutations in this gene have been associated with disorders related to dopaminergic dysfunction, including Parkinson disease, schizophernia, and manic depression. Misregulation of this gene may be associated with rheumatoid arthritis. Alternatively spliced transcript variants have been described, but their biological validity has not been determined.

Anti-NR4A2 Antibody
STJ501990	St John's Laboratory	100 µg	EUR 476

Anti-NR4A2 antibody
STJ192441	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to NR4A2

NR4A2 siRNA
20-abx903651	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NR4A2 siRNA
20-abx926353	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NR4A2 siRNA
20-abx926354	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti- Nurr1/NR4A2 antibody
FNab05936	FN Test	100µg	EUR 585
Immunogen: nuclear receptor subfamily 4, group A, member 2 Uniprot ID: P43354 Research Area: Neuroscience, Signal Transduction, Metabolism, Developmental biology
Description: Antibody raised against Nurr1/NR4A2

Anti-Nurr1/NR4A2 antibody
PAab05936	Lifescience Market	100 ug	EUR 412

Anti-Nurr1/NR4A2 Antibody
PB9297	BosterBio	100ug/vial	EUR 294

Anti-NR4A2 Antibody (Biotin)
STJ501991	St John's Laboratory	100 µg	EUR 586

Anti-NR4A2 Antibody (FITC)
STJ501992	St John's Laboratory	100 µg	EUR 586

NR4A2 cloning plasmid
CSB-CL016063HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1797 Sequence: atgccttgtgttcaggcgcagtatgggtcctcgcctcaaggagccagccccgcttctcagagctacagttaccactcttcgggagaatacagctccgatttcttaactccagagtttgtcaagtttagcatggacctcaccaacactgaaatcactgccaccacttctctcccca Show more
Description: A cloning plasmid for the NR4A2 gene.

Anti-NR4A2 (4A6)
YF-MA20377	Abfrontier	200 ul	EUR 363
Description: Mouse monoclonal to NR4A2

NR4A2 Rabbit Polyclonal Antibody