Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG


FHL2 Rabbit Polyclonal Antibody

FHL2 Rabbit Polyclonal Antibody

Contact us: [email protected]

FHL2 Polyclonal Antibody

ABP58553-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human FHL2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of FHL2 from Human, Mouse, Rat. This FHL2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FHL2 protein

FHL2 Polyclonal Antibody

ES11019-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against FHL2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

FHL2 Polyclonal Antibody

ES11019-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against FHL2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

FHL2 Rabbit pAb

A1907-100ul 100 ul
EUR 308

FHL2 Rabbit pAb

A1907-200ul 200 ul
EUR 459

FHL2 Rabbit pAb

A1907-20ul 20 ul
EUR 183

FHL2 Rabbit pAb

A1907-50ul 50 ul
EUR 223

FHL2 antibody

20R-1089 100 ug
EUR 377
Description: Rabbit polyclonal FHL2 antibody

FHL2 Antibody

21692-100ul 100ul
EUR 252

FHL2 Antibody

21692-50ul 50ul
EUR 187

FHL2 antibody

70R-17302 50 ul
EUR 435
Description: Rabbit polyclonal FHL2 antibody

FHL2 antibody

10R-10403 100 ug
EUR 435
Description: Mouse monoclonal FHL2 antibody

FHL2 Antibody

49904-100ul 100ul
EUR 333

FHL2 Antibody

49904-50ul 50ul
EUR 239

FHL2 Antibody

EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against FHL2. Recognizes FHL2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

FHL2 Antibody

CSB-PA131696-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against FHL2. Recognizes FHL2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

FHL2 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FHL2. Recognizes FHL2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

FHL2 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FHL2. Recognizes FHL2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:50-1:200

FHL2 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FHL2. Recognizes FHL2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:100-1:300

FHL2 Antibody

DF13015 200ul
EUR 304
Description: FHL2 Antibody detects endogenous levels of FHL2.

FHL2 antibody

70R-49745 100 ul
EUR 244
Description: Purified Polyclonal FHL2 antibody

FHL2 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against FHL2. Recognizes FHL2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

FHL2 Conjugated Antibody

C49904 100ul
EUR 397

FHL2 Conjugated Antibody

C21692 100ul
EUR 397

anti- FHL2 antibody

FNab03111 100µg
EUR 505.25
  • Immunogen: four and a half LIM domains 2
  • Uniprot ID: Q14192
  • Gene ID: 2274
  • Research Area: Metabolism, Developmental biology
Description: Antibody raised against FHL2

Anti-FHL2 antibody

PAab03111 100 ug
EUR 355

Anti-FHL2 antibody

STJ23664 100 µl
EUR 277
Description: This gene encodes a member of the four-and-a-half-LIM-only protein family. Family members contain two highly conserved, tandemly arranged, zinc finger domains with four highly conserved cysteines binding a zinc atom in each zinc finger. This protein is thought to have a role in the assembly of extracellular membranes. Also, this gene is down-regulated during transformation of normal myoblasts to rhabdomyosarcoma cells and the encoded protein may function as a link between presenilin-2 and an intracellular signaling pathway. Multiple alternatively spliced variants encoding different isoforms have been identified.

Anti-FHL2 antibody

STJ70520 100 µg
EUR 359

Anti-FHL2 antibody

STJ192177 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to FHL2

Fhl2/ Rat Fhl2 ELISA Kit

ELI-32523r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA11787 50 ul
EUR 363
Description: Mouse polyclonal to FHL2


YF-PA11788 100 ug
EUR 403
Description: Rabbit polyclonal to FHL2


YF-PA23715 50 ul
EUR 334
Description: Mouse polyclonal to FHL2

FHL2 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FHL2. Recognizes FHL2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

FHL2 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FHL2. Recognizes FHL2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

FHL2 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FHL2. Recognizes FHL2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

FHL2 Blocking Peptide

33R-7909 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FHL2 antibody, catalog no. 20R-1089

FHL2 Blocking Peptide

DF13015-BP 1mg
EUR 195

FHL2 cloning plasmid

CSB-CL617906HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 840
  • Sequence: atgactgagcgctttgactgccaccattgcaacgaatctctctttggcaagaagtacatcctgcgggaggagagcccctactgcgtggtgtgctttgagaccctgttcgccaacacctgcgaggagtgtgggaagcccatcggctgtgactgcaaggacttgtcttacaaggaccg
  • Show more
Description: A cloning plasmid for the FHL2 gene.

FHL2 protein (His tag)

80R-3992 100 ug
EUR 435
Description: Recombinant Human FHL2 protein


EF009627 96 Tests
EUR 689

Rat FHL2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse FHL2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human FHL2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

FHL2 Recombinant Protein (Human)

RP012169 100 ug Ask for price

FHL2 Recombinant Protein (Rat)

RP201398 100 ug Ask for price

FHL2 Recombinant Protein (Mouse)

RP134600 100 ug Ask for price

Anti-FHL2 (2G3-1A5)

YF-MA13025 100 ug
EUR 363
Description: Mouse monoclonal to FHL2

Fhl2 ORF Vector (Rat) (pORF)

ORF067134 1.0 ug DNA
EUR 506

FHL2 ORF Vector (Human) (pORF)

ORF004057 1.0 ug DNA
EUR 95

Fhl2 ORF Vector (Mouse) (pORF)

ORF044868 1.0 ug DNA
EUR 506

FHL2 ELISA Kit (Mouse) (OKEH03684)

OKEH03684 96 Wells
EUR 779
Description: Description of target: May function as a molecular transmitter linking various signaling pathways to transcriptional regulation. Negatively regulates the transcriptional repressor E4F1 and may function in cell growth. Inhibits the transcriptional activity of FOXO1 and its apoptotic function by enhancing the interaction of FOXO1 with SIRT1 and FOXO1 deacetylation.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.09 pg/mL

Fhl2 sgRNA CRISPR Lentivector set (Rat)

K6889701 3 x 1.0 ug
EUR 339

FHL2 sgRNA CRISPR Lentivector set (Human)

K0781901 3 x 1.0 ug
EUR 339

Fhl2 sgRNA CRISPR Lentivector set (Mouse)

K3796201 3 x 1.0 ug
EUR 339

Fhl2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6889702 1.0 ug DNA
EUR 154

Fhl2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6889703 1.0 ug DNA
EUR 154

Fhl2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6889704 1.0 ug DNA
EUR 154

FHL2 sgRNA CRISPR Lentivector (Human) (Target 1)

K0781902 1.0 ug DNA
EUR 154

FHL2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0781903 1.0 ug DNA
EUR 154

FHL2 sgRNA CRISPR Lentivector (Human) (Target 3)

K0781904 1.0 ug DNA
EUR 154

Fhl2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3796202 1.0 ug DNA
EUR 154

Fhl2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3796203 1.0 ug DNA
EUR 154

Fhl2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3796204 1.0 ug DNA
EUR 154

FHL2 Protein Vector (Mouse) (pPB-C-His)

PV179470 500 ng
EUR 603

FHL2 Protein Vector (Mouse) (pPB-N-His)

PV179471 500 ng
EUR 603

FHL2 Protein Vector (Mouse) (pPM-C-HA)

PV179472 500 ng
EUR 603

FHL2 Protein Vector (Mouse) (pPM-C-His)

PV179473 500 ng
EUR 603

FHL2 Protein Vector (Rat) (pPB-C-His)

PV268534 500 ng
EUR 603

FHL2 Protein Vector (Rat) (pPB-N-His)

PV268535 500 ng
EUR 603

FHL2 Protein Vector (Rat) (pPM-C-HA)

PV268536 500 ng
EUR 603

FHL2 Protein Vector (Rat) (pPM-C-His)

PV268537 500 ng
EUR 603

FHL2 Protein Vector (Human) (pPB-C-His)

PV016225 500 ng
EUR 329

FHL2 Protein Vector (Human) (pPB-N-His)

PV016226 500 ng
EUR 329

FHL2 Protein Vector (Human) (pPM-C-HA)

PV016227 500 ng
EUR 329

FHL2 Protein Vector (Human) (pPM-C-His)

PV016228 500 ng
EUR 329

Recombinant Human FHL2 Protein, His, E.coli-1mg

QP11879-1mg 1mg
EUR 3655

Recombinant Human FHL2 Protein, His, E.coli-25ug

QP11879-25ug 25ug
EUR 201

Recombinant Human FHL2 Protein, His, E.coli-5ug

QP11879-5ug 5ug
EUR 155

Fhl2 3'UTR GFP Stable Cell Line

TU156569 1.0 ml Ask for price

Fhl2 3'UTR Luciferase Stable Cell Line

TU106569 1.0 ml Ask for price

Fhl2 3'UTR Luciferase Stable Cell Line

TU204633 1.0 ml Ask for price

Fhl2 3'UTR GFP Stable Cell Line

TU254633 1.0 ml Ask for price

FHL2 3'UTR GFP Stable Cell Line

TU057968 1.0 ml
EUR 4617

FHL2 3'UTR Luciferase Stable Cell Line

TU007968 1.0 ml
EUR 4617

Four And A Half LIM Domains Protein 2 (FHL2) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Four And A Half LIM Domains Protein 2 (FHL2) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Four And A Half LIM Domains Protein 2 (FHL2) Antibody

abx018189-100ug 100 ug
EUR 384
  • Shipped within 5-10 working days.

Four And A Half LIM Domains Protein 2 (FHL2) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Four And A Half LIM Domains Protein 2 (FHL2) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Four And A Half LIM Domains Protein 2 (FHL2) Antibody

abx145821-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Four And A Half LIM Domains Protein 2 (FHL2) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Four And A Half LIM Domains Protein 2 (FHL2) Antibody

abx233111-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Four And A Half LIM Domains Protein 2 (FHL2) Antibody

abx330443-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Four And A Half LIM Domains Protein 2 (FHL2) Antibody

abx431253-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

FHL2 Rabbit Polyclonal Antibody

Recent Posts


January 2022
