PAX3 Rabbit Polyclonal Antibody
Contact us: [email protected]
 PAX3 Polyclonal Antibody |
|
ES11259-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against PAX3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PAX3 Polyclonal Antibody |
|
ES11259-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against PAX3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
 PAX3 Rabbit pAb |
|
A13930-100ul |
Abclonal |
100 ul |
EUR 308 |
PAX3 Rabbit pAb |
|
A13930-200ul |
Abclonal |
200 ul |
EUR 459 |
PAX3 Rabbit pAb |
|
A13930-20ul |
Abclonal |
20 ul |
EUR 183 |
PAX3 Rabbit pAb |
|
A13930-50ul |
Abclonal |
50 ul |
EUR 223 |
PAX3 Rabbit pAb |
|
A1675-100ul |
Abclonal |
100 ul |
EUR 308 |
PAX3 Rabbit pAb |
|
A1675-200ul |
Abclonal |
200 ul |
EUR 459 |
PAX3 Rabbit pAb |
|
A1675-20ul |
Abclonal |
20 ul |
EUR 183 |
PAX3 Rabbit pAb |
|
A1675-50ul |
Abclonal |
50 ul |
EUR 223 |
 PAX3 antibody |
|
70R-19126 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal PAX3 antibody |
 PAX3 Antibody |
|
32380-100ul |
SAB |
100ul |
EUR 252 |
PAX3 antibody |
|
10R-1480 |
Fitzgerald |
100 ug |
EUR 512 |
|
Description: Mouse monoclonal PAX3 antibody |
PAX3 Antibody |
|
DF6548 |
Affbiotech |
200ul |
EUR 304 |
|
Description: PAX3 Antibody detects endogenous levels of total PAX3. |
PAX3 Antibody |
|
1-CSB-PA017489GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against PAX3. Recognizes PAX3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
PAX3 Antibody |
|
1-CSB-PA017489HA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against PAX3. Recognizes PAX3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:100-1:500, IF:1:50-1:500 |
 Polyclonal Goat Anti-PAX3 Antibody |
|
APR16352G |
Leading Biology |
0.1 mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-PAX3 . This antibody is tested and proven to work in the following applications: |
) Polyclonal PAX3 Antibody (internal region) |
|
APG00797G |
Leading Biology |
0.1mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human PAX3 (internal region). This antibody is tested and proven to work in the following applications: |
 PAX3 Polyclonal Antibody, HRP Conjugated |
|
A50405 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 PAX3 Polyclonal Antibody, FITC Conjugated |
|
A50406 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: kits suitable for this type of research |
 PAX3 Polyclonal Antibody, Biotin Conjugated |
|
A50407 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: fast delivery possible |
 PAX3 |
|
P41025 |
Neuromics |
100 ug Blocking Peptide |
EUR 239 |
 Polyclonal PAX3 antibody - N-terminal region |
|
APR00611G |
Leading Biology |
0.05mg |
EUR 528 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PAX3 - N-terminal region. This antibody is tested and proven to work in the following applications: |
 Polyclonal PAX3 antibody - C-terminal region |
|
APR00619G |
Leading Biology |
0.05mg |
EUR 528 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PAX3 - C-terminal region. This antibody is tested and proven to work in the following applications: |
 PAX3 Conjugated Antibody |
|
C32380 |
SAB |
100ul |
EUR 397 |
 Anti-PAX3 Antibody |
|
A1657-100 |
Biovision |
|
EUR 370 |
 anti- PAX3 antibody |
|
FNab06169 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:500-1:2000
- IP: 1:500-1:1000
- Immunogen: paired box 3
- Uniprot ID: P23760
- Gene ID: 5077
- Research Area: Neuroscience, Stem Cells, Metabolism, Developmental biology
|
|
Description: Antibody raised against PAX3 |
anti- PAX3 antibody |
|
FNab06170 |
FN Test |
100µg |
EUR 585 |
- Immunogen: paired box 3
- Uniprot ID: P23760
- Gene ID: 5077
- Research Area: Neuroscience, Stem Cells, Metabolism, Developmental biology
|
|
Description: Antibody raised against PAX3 |
 Anti-PAX3 antibody |
|
STJ24909 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: This gene is a member of the paired box (PAX) family of transcription factors. Members of the PAX family typically contain a paired box domain and a paired-type homeodomain. These genes play critical roles during fetal development. Mutations in paired box gene 3 are associated with Waardenburg syndrome, craniofacial-deafness-hand syndrome, and alveolar rhabdomyosarcoma. The translocation t(2;13)(q35;q14), which represents a fusion between PAX3 and the forkhead gene, is a frequent finding in alveolar rhabdomyosarcoma. Alternative splicing results in transcripts encoding isoforms with different C-termini. |
Anti-PAX3 antibody |
|
STJ115865 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: This gene is a member of the paired box (PAX) family of transcription factors. Members of the PAX family typically contain a paired box domain and a paired-type homeodomain. These genes play critical roles during fetal development. Mutations in paired box gene 3 are associated with Waardenburg syndrome, craniofacial-deafness-hand syndrome, and alveolar rhabdomyosarcoma. The translocation t(2;13)(q35;q14), which represents a fusion between PAX3 and the forkhead gene, is a frequent finding in alveolar rhabdomyosarcoma. Alternative splicing results in transcripts encoding isoforms with different C-termini. |
Anti-PAX3 antibody |
|
STJ192417 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to PAX3 |
 PAX3 siRNA |
|
20-abx927803 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PAX3 siRNA |
|
20-abx927804 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-PAX3 |
|
YF-PA13616 |
Abfrontier |
100 ug |
EUR 403 |
|
Description: Rabbit polyclonal to PAX3 |
anti-PAX3 |
|
YF-PA13617 |
Abfrontier |
100 ug |
EUR 403 |
|
Description: Rabbit polyclonal to PAX3 |
anti-PAX3 |
|
YF-PA24304 |
Abfrontier |
50 ul |
EUR 334 |
|
Description: Mouse polyclonal to PAX3 |
 PAX3 Antibody, HRP conjugated |
|
1-CSB-PA017489HB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against PAX3. Recognizes PAX3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 PAX3 Antibody, FITC conjugated |
|
1-CSB-PA017489HC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against PAX3. Recognizes PAX3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 PAX3 Antibody, Biotin conjugated |
|
1-CSB-PA017489HD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against PAX3. Recognizes PAX3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 PAX3 Blocking Peptide |
|
DF6548-BP |
Affbiotech |
1mg |
EUR 195 |
 PAX3 cloning plasmid |
|
CSB-CL017489HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 621
- Sequence: atgaccacgctggccggcgctgtgcccaggatgatgcggccgggcccggggcagaactacccgcgtagcgggttcccgctggaagtgtccactcccctcggccagggccgcgtcaaccagctcggcggcgtttttatcaacggcaggccgctgcccaaccacatccgccataagat
- Show more
|
|
Description: A cloning plasmid for the PAX3 gene. |
PAX3 cloning plasmid |
|
CSB-CL017489HU2-10ug |
Cusabio |
10ug |
EUR 517 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1455
- Sequence: ATGACCACGCTGGCCGGCGCTGTGCCCAGGATGATGCGGCCGGGCCCGGGGCAGAACTACCCGCGTAGCGGGTTCCCGCTGGAAGTGTCCACTCCCCTCGGCCAGGGCCGCGTCAACCAGCTCGGCGGCGTTTTTATCAACGGCAGGCCGCTGCCCAACCACATCCGCCACAAGA
- Show more
|
|
Description: A cloning plasmid for the PAX3 gene. |
) Anti-PAX3 (4F4) |
|
YF-MA14594 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to PAX3 |
) Anti-PAX3 (3A8) |
|
YF-MA14595 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to PAX3 |
 Antibody) Paired Box 3 (PAX3) Antibody |
|
abx015952-100ul |
Abbexa |
100 ul |
EUR 411 |
- Shipped within 5-10 working days.
|
Paired Box 3 (PAX3) Antibody |
|
abx015953-100ug |
Abbexa |
100 ug |
EUR 411 |
- Shipped within 5-10 working days.
|
Paired Box 3 (PAX3) Antibody |
|
20-abx114310 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Paired Box 3 (PAX3) Antibody |
|
abx236169-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Paired Box 3 (PAX3) Antibody |
|
abx236170-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Paired Box 3 (PAX3) Antibody |
|
abx431489-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Paired Box 3 (PAX3) Antibody |
|
abx431490-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
 Monoclonal PAX3 Antibody, Clone: 7D8G7 |
|
AMM03117G |
Leading Biology |
0.1ml |
EUR 528 |
|
Description: A Monoclonal antibody against Human PAX3. The antibodies are raised in Mouse and are from clone 7D8G7. This antibody is applicable in WB, E |
Monoclonal PAX3 Antibody, Clone: 7D8G7 |
|
AMM03118G |
Leading Biology |
0.1ml |
EUR 528 |
|
Description: A Monoclonal antibody against Human PAX3. The antibodies are raised in Mouse and are from clone 7D8G7. This antibody is applicable in WB, E |
) Anti-Pax3 Antibody (Monoclonal, C2) |
|
M00285 |
BosterBio |
100ug/vial |
EUR 397 |
|
Description: Mouse Monoclonal Pax3 Antibody (Monoclonal, C2). Validated in IHC, WB and tested in Human. |
 Antibody (Biotin)) Paired Box 3 (PAX3) Antibody (Biotin) |
|
abx431491-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
 Mouse PAX3 shRNA Plasmid |
|
20-abx971929 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human PAX3 shRNA Plasmid |
|
20-abx953375 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) Pax3 Recombinant Protein (Human) |
|
RP022621 |
ABM |
100 ug |
Ask for price |
Pax3 Recombinant Protein (Human) |
|
RP042043 |
ABM |
100 ug |
Ask for price |
) Pax3 Recombinant Protein (Mouse) |
|
RP160262 |
ABM |
100 ug |
Ask for price |
Pax3 Recombinant Protein (Mouse) |
|
RP160265 |
ABM |
100 ug |
Ask for price |
) Pax3 Recombinant Protein (Rat) |
|
RP219383 |
ABM |
100 ug |
Ask for price |
 Antibody) Paired Box Protein Pax-3 (PAX3) Antibody |
|
20-abx142126 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Paired Box Protein Pax-3 (PAX3) Antibody |
|
abx031811-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Paired Box Protein Pax-3 (PAX3) Antibody |
|
abx031811-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Paired Box Protein Pax-3 (PAX3) Antibody |
|
20-abx302629 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Paired Box Protein Pax-3 (PAX3) Antibody |
|
20-abx001407 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
 (pORF)) Pax3 ORF Vector (Rat) (pORF) |
|
ORF073129 |
ABM |
1.0 ug DNA |
EUR 506 |
 h PAX3 inducible lentiviral particles |
|
LVP491 |
GenTarget |
1x107 IFU/ml x 200ul |
EUR 451 |
|
Description: Pre-made optional inducible lentiviral particles for expressing human target: h PAX3 (alternative name: CDHS, HUP2, WS1, WS3). The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_013942.4. Particles also contains a RFP-Blasticidin dual selection marker. |
 (pORF)) PAX3 ORF Vector (Human) (pORF) |
|
ORF014015 |
ABM |
1.0 ug DNA |
EUR 354 |
PAX3 ORF Vector (Human) (pORF) |
|
ORF007541 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Pax3 ORF Vector (Mouse) (pORF) |
|
ORF053422 |
ABM |
1.0 ug DNA |
EUR 506 |
Pax3 ORF Vector (Mouse) (pORF) |
|
ORF053423 |
ABM |
1.0 ug DNA |
EUR 506 |
 Antibody (HRP)) Paired Box Protein Pax-3 (PAX3) Antibody (HRP) |
|
20-abx304745 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (FITC)) Paired Box Protein Pax-3 (PAX3) Antibody (FITC) |
|
20-abx304746 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (Biotin)) Paired Box Protein Pax-3 (PAX3) Antibody (Biotin) |
|
20-abx304747 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
) Pax3 sgRNA CRISPR Lentivector set (Rat) |
|
K6937701 |
ABM |
3 x 1.0 ug |
EUR 339 |
) PAX3 sgRNA CRISPR Lentivector set (Human) |
|
K1598501 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Pax3 sgRNA CRISPR Lentivector set (Mouse) |
|
K4702801 |
ABM |
3 x 1.0 ug |
EUR 339 |
, Clone: C2) Monoclonal PAX3 Antibody (C-Terminus, clone C2), Clone: C2 |
|
AMM01846G |
Leading Biology |
0.05mg |
EUR 484 |
|
Description: A Monoclonal antibody against Human PAX3 (C-Terminus, clone C2). The antibodies are raised in Mouse and are from clone C2. This antibody is applicable in WB and IHC-P |
 (Target 1)) Pax3 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6937702 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Pax3 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6937703 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Pax3 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6937704 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) PAX3 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K1598502 |
ABM |
1.0 ug DNA |
EUR 154 |
PAX3 Rabbit Polyclonal Antibody
)
)
