Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG


PAX3 Rabbit Polyclonal Antibody

PAX3 Rabbit Polyclonal Antibody

Contact us: [email protected]

PAX3 Polyclonal Antibody

ES11259-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PAX3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

PAX3 Polyclonal Antibody

ES11259-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PAX3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

PAX3 Rabbit pAb

A13930-100ul 100 ul
EUR 308

PAX3 Rabbit pAb

A13930-200ul 200 ul
EUR 459

PAX3 Rabbit pAb

A13930-20ul 20 ul
EUR 183

PAX3 Rabbit pAb

A13930-50ul 50 ul
EUR 223

PAX3 Rabbit pAb

A1675-100ul 100 ul
EUR 308

PAX3 Rabbit pAb

A1675-200ul 200 ul
EUR 459

PAX3 Rabbit pAb

A1675-20ul 20 ul
EUR 183

PAX3 Rabbit pAb

A1675-50ul 50 ul
EUR 223

PAX3 antibody

70R-19126 50 ul
EUR 435
Description: Rabbit polyclonal PAX3 antibody

PAX3 Antibody

32380-100ul 100ul
EUR 252

PAX3 antibody

10R-1480 100 ug
EUR 512
Description: Mouse monoclonal PAX3 antibody

PAX3 Antibody

DF6548 200ul
EUR 304
Description: PAX3 Antibody detects endogenous levels of total PAX3.

PAX3 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PAX3. Recognizes PAX3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB

PAX3 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PAX3. Recognizes PAX3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:100-1:500, IF:1:50-1:500

PAX3 Antibody

ABD6548 100 ug
EUR 438

Polyclonal Goat Anti-PAX3 Antibody

APR16352G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-PAX3 . This antibody is tested and proven to work in the following applications:

Polyclonal PAX3 Antibody (internal region)

APG00797G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human PAX3 (internal region). This antibody is tested and proven to work in the following applications:

PAX3 Polyclonal Antibody, HRP Conjugated

A50405 100 µg
EUR 570.55
Description: The best epigenetics products

PAX3 Polyclonal Antibody, FITC Conjugated

A50406 100 µg
EUR 570.55
Description: kits suitable for this type of research

PAX3 Polyclonal Antibody, Biotin Conjugated

A50407 100 µg
EUR 570.55
Description: fast delivery possible


GT41025 100 ug
EUR 487


P41025 100 ug Blocking Peptide
EUR 239

Polyclonal PAX3 antibody - N-terminal region

APR00611G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PAX3 - N-terminal region. This antibody is tested and proven to work in the following applications:

Polyclonal PAX3 antibody - C-terminal region

APR00619G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PAX3 - C-terminal region. This antibody is tested and proven to work in the following applications:

PAX3 Conjugated Antibody

C32380 100ul
EUR 397

Anti-PAX3 Antibody

EUR 370

anti- PAX3 antibody

FNab06169 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • IP: 1:500-1:1000
  • Immunogen: paired box 3
  • Uniprot ID: P23760
  • Gene ID: 5077
  • Research Area: Neuroscience, Stem Cells, Metabolism, Developmental biology
Description: Antibody raised against PAX3

anti- PAX3 antibody

FNab06170 100µg
EUR 585
  • Immunogen: paired box 3
  • Uniprot ID: P23760
  • Gene ID: 5077
  • Research Area: Neuroscience, Stem Cells, Metabolism, Developmental biology
Description: Antibody raised against PAX3

Anti-PAX3 antibody

PAab06169 100 ug
EUR 355

Anti-PAX3 antibody

PAab06170 100 ug
EUR 412

Anti-PAX3 antibody

STJ24909 100 µl
EUR 277
Description: This gene is a member of the paired box (PAX) family of transcription factors. Members of the PAX family typically contain a paired box domain and a paired-type homeodomain. These genes play critical roles during fetal development. Mutations in paired box gene 3 are associated with Waardenburg syndrome, craniofacial-deafness-hand syndrome, and alveolar rhabdomyosarcoma. The translocation t(2;13)(q35;q14), which represents a fusion between PAX3 and the forkhead gene, is a frequent finding in alveolar rhabdomyosarcoma. Alternative splicing results in transcripts encoding isoforms with different C-termini.

Anti-PAX3 antibody

STJ115865 100 µl
EUR 277
Description: This gene is a member of the paired box (PAX) family of transcription factors. Members of the PAX family typically contain a paired box domain and a paired-type homeodomain. These genes play critical roles during fetal development. Mutations in paired box gene 3 are associated with Waardenburg syndrome, craniofacial-deafness-hand syndrome, and alveolar rhabdomyosarcoma. The translocation t(2;13)(q35;q14), which represents a fusion between PAX3 and the forkhead gene, is a frequent finding in alveolar rhabdomyosarcoma. Alternative splicing results in transcripts encoding isoforms with different C-termini.

Anti-PAX3 antibody

STJ70536 100 µg
EUR 359

Anti-PAX3 antibody

STJ72735 100 µg
EUR 359

Anti-PAX3 antibody

STJ192417 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PAX3

Anti-PAX3 Antibody

STJ502149 100 µg
EUR 476


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA13616 100 ug
EUR 403
Description: Rabbit polyclonal to PAX3


YF-PA13617 100 ug
EUR 403
Description: Rabbit polyclonal to PAX3


YF-PA24304 50 ul
EUR 334
Description: Mouse polyclonal to PAX3

PAX3 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PAX3. Recognizes PAX3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PAX3 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PAX3. Recognizes PAX3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PAX3 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PAX3. Recognizes PAX3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-PAX3, Biotinylated antibody

STJ73289 100 µg
EUR 359

Anti-PAX3 Antibody (Biotin)

STJ502150 100 µg
EUR 586

Anti-PAX3 Antibody (FITC)

STJ502151 100 µg
EUR 586

PAX3 Blocking Peptide

DF6548-BP 1mg
EUR 195

PAX3 cloning plasmid

CSB-CL017489HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 621
  • Sequence: atgaccacgctggccggcgctgtgcccaggatgatgcggccgggcccggggcagaactacccgcgtagcgggttcccgctggaagtgtccactcccctcggccagggccgcgtcaaccagctcggcggcgtttttatcaacggcaggccgctgcccaaccacatccgccataagat
  • Show more
Description: A cloning plasmid for the PAX3 gene.

PAX3 cloning plasmid

CSB-CL017489HU2-10ug 10ug
EUR 517
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1455
  • Show more
Description: A cloning plasmid for the PAX3 gene.

Anti-PAX3 (4F4)

YF-MA14594 100 ug
EUR 363
Description: Mouse monoclonal to PAX3

Anti-PAX3 (3A8)

YF-MA14595 100 ug
EUR 363
Description: Mouse monoclonal to PAX3

Paired Box 3 (PAX3) Antibody

abx015952-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

Paired Box 3 (PAX3) Antibody

abx015953-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

Paired Box 3 (PAX3) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Paired Box 3 (PAX3) Antibody

abx236169-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Paired Box 3 (PAX3) Antibody

abx236170-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Paired Box 3 (PAX3) Antibody

abx431489-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Paired Box 3 (PAX3) Antibody

abx431490-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Monoclonal PAX3 Antibody, Clone: 7D8G7

AMM03117G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human PAX3. The antibodies are raised in Mouse and are from clone 7D8G7. This antibody is applicable in WB, E

Monoclonal PAX3 Antibody, Clone: 7D8G7

AMM03118G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human PAX3. The antibodies are raised in Mouse and are from clone 7D8G7. This antibody is applicable in WB, E

Anti-Pax3 Antibody (Monoclonal, C2)

M00285 100ug/vial
EUR 397
Description: Mouse Monoclonal Pax3 Antibody (Monoclonal, C2). Validated in IHC, WB and tested in Human.

Paired Box 3 (PAX3) Antibody (Biotin)

abx431491-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.


EF001577 96 Tests
EUR 689

Mouse PAX3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PAX3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Pax3 Recombinant Protein (Human)

RP022621 100 ug Ask for price

Pax3 Recombinant Protein (Human)

RP042043 100 ug Ask for price

Pax3 Recombinant Protein (Mouse)

RP160262 100 ug Ask for price

Pax3 Recombinant Protein (Mouse)

RP160265 100 ug Ask for price

Pax3 Recombinant Protein (Rat)

RP219383 100 ug Ask for price

Paired Box Protein Pax-3 (PAX3) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Paired Box Protein Pax-3 (PAX3) Antibody

abx031811-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Paired Box Protein Pax-3 (PAX3) Antibody

abx031811-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Paired Box Protein Pax-3 (PAX3) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Paired Box Protein Pax-3 (PAX3) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Pax3 ORF Vector (Rat) (pORF)

ORF073129 1.0 ug DNA
EUR 506

h PAX3 inducible lentiviral particles

LVP491 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made optional inducible lentiviral particles for expressing human target: h PAX3 (alternative name: CDHS, HUP2, WS1, WS3). The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_013942.4. Particles also contains a RFP-Blasticidin dual selection marker.

PAX3 ORF Vector (Human) (pORF)

ORF014015 1.0 ug DNA
EUR 354

PAX3 ORF Vector (Human) (pORF)

ORF007541 1.0 ug DNA
EUR 95

Pax3 ORF Vector (Mouse) (pORF)

ORF053422 1.0 ug DNA
EUR 506

Pax3 ORF Vector (Mouse) (pORF)

ORF053423 1.0 ug DNA
EUR 506

pECMV-Pax3-m-FLAG Plasmid

PVT15782 2 ug
EUR 325

Paired Box Protein Pax-3 (PAX3) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Paired Box Protein Pax-3 (PAX3) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Paired Box Protein Pax-3 (PAX3) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Pax3 sgRNA CRISPR Lentivector set (Rat)

K6937701 3 x 1.0 ug
EUR 339

PAX3 sgRNA CRISPR Lentivector set (Human)

K1598501 3 x 1.0 ug
EUR 339

Pax3 sgRNA CRISPR Lentivector set (Mouse)

K4702801 3 x 1.0 ug
EUR 339

Monoclonal PAX3 Antibody (C-Terminus, clone C2), Clone: C2

AMM01846G 0.05mg
EUR 484
Description: A Monoclonal antibody against Human PAX3 (C-Terminus, clone C2). The antibodies are raised in Mouse and are from clone C2. This antibody is applicable in WB and IHC-P

Pax3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6937702 1.0 ug DNA
EUR 154

Pax3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6937703 1.0 ug DNA
EUR 154

Pax3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6937704 1.0 ug DNA
EUR 154

PAX3 sgRNA CRISPR Lentivector (Human) (Target 1)

K1598502 1.0 ug DNA
EUR 154

PAX3 Rabbit Polyclonal Antibody

Recent Posts


January 2022
