Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG


PGS1 Rabbit Polyclonal Antibody

PGS1 Rabbit Polyclonal Antibody

Contact us: [email protected]

PGS1 Polyclonal Antibody

A64890 100 µg
EUR 570.55
Description: Ask the seller for details

PGS1 Polyclonal Antibody

ABP59893-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human PGS1 protein at amino acid sequence of 110-190
  • Applications tips:
Description: A polyclonal antibody for detection of PGS1 from Human, Mouse, Rat. This PGS1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PGS1 protein at amino acid sequence of 110-190

PGS1 Polyclonal Antibody

ABP59893-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PGS1 protein at amino acid sequence of 110-190
  • Applications tips:
Description: A polyclonal antibody for detection of PGS1 from Human, Mouse, Rat. This PGS1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PGS1 protein at amino acid sequence of 110-190

PGS1 Polyclonal Antibody

ABP59893-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PGS1 protein at amino acid sequence of 110-190
  • Applications tips:
Description: A polyclonal antibody for detection of PGS1 from Human, Mouse, Rat. This PGS1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PGS1 protein at amino acid sequence of 110-190

PGS1 Polyclonal Antibody

ES11314-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PGS1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

PGS1 Polyclonal Antibody

ES11314-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PGS1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

PGS1 Rabbit pAb

A14308-100ul 100 ul
EUR 308

PGS1 Rabbit pAb

A14308-200ul 200 ul
EUR 459

PGS1 Rabbit pAb

A14308-20ul 20 ul
EUR 183

PGS1 Rabbit pAb

A14308-50ul 50 ul
EUR 223

PGS1 Rabbit pAb

A4309-100ul 100 ul
EUR 308

PGS1 Rabbit pAb

A4309-200ul 200 ul
EUR 459

PGS1 Rabbit pAb

A4309-20ul 20 ul Ask for price

PGS1 Rabbit pAb

A4309-50ul 50 ul Ask for price

PGS1 Polyclonal Conjugated Antibody

C28496 100ul
EUR 397

Polyclonal PGS1 Antibody (Center)

APR09102G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PGS1 (Center). This antibody is tested and proven to work in the following applications:

PGS1 antibody

70R-19249 50 ul
EUR 435
Description: Rabbit polyclonal PGS1 antibody

PGS1 antibody

70R-1011 100 ug
EUR 377
Description: Rabbit polyclonal PGS1 antibody raised against the C terminal of PGS1

PGS1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PGS1. Recognizes PGS1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

PGS1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PGS1. Recognizes PGS1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF

PGS1 antibody

70R-5274 50 ug
EUR 467
Description: Rabbit polyclonal PGS1 antibody raised against the C terminal of PGS1

PGS1 Polyclonal Antibody, HRP Conjugated

A64891 100 µg
EUR 570.55
Description: The best epigenetics products

PGS1 Polyclonal Antibody, FITC Conjugated

A64892 100 µg
EUR 570.55
Description: kits suitable for this type of research

PGS1 Polyclonal Antibody, Biotin Conjugated

A64893 100 µg
EUR 570.55
Description: fast delivery possible

anti- PGS1 antibody

FNab06367 100µg
EUR 548.75
  • Immunogen: phosphatidylglycerophosphate synthase 1
  • Uniprot ID: Q32NB8
  • Gene ID: 9489
  • Research Area: Metabolism
Description: Antibody raised against PGS1

Anti-PGS1 antibody

PAab06367 100 ug
EUR 386

Anti-PGS1 antibody

STJ26613 100 µl
EUR 277

Anti-PGS1 antibody

STJ116520 100 µl
EUR 277

Anti-PGS1 antibody

STJ192472 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PGS1


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA16343 50 ug
EUR 363
Description: Mouse polyclonal to PGS1

PGS1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PGS1. Recognizes PGS1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PGS1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PGS1. Recognizes PGS1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PGS1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PGS1. Recognizes PGS1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PGS1 Blocking Peptide

33R-8255 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PGS1 antibody, catalog no. 70R-1011

PGS1 Blocking Peptide

33R-7584 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PGS1 antibody, catalog no. 70R-5274

PGS1 cloning plasmid

CSB-CL653479HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1344
  • Sequence: atgaaggggcagataagagtagccaagaggcgggtcgtgatggcatccctctacctggggacaggtcctttggaacaggagctggtggactgcctggaaagtactctagaaaagtcactccaagcaaagtttccttcaaatctcaaggtctccattctcttagacttcacgcggg
  • Show more
Description: A cloning plasmid for the PGS1 gene.

Phosphatidylglycerophosphate Synthase 1 (PGS1) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Phosphatidylglycerophosphate Synthase 1 (PGS1) Antibody

abx029732-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Phosphatidylglycerophosphate Synthase 1 (PGS1) Antibody

abx029732-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Phosphatidylglycerophosphate Synthase 1 (PGS1) Antibody

abx236367-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Phosphatidylglycerophosphate Synthase 1 (PGS1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phosphatidylglycerophosphate Synthase 1 (PGS1) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phosphatidylglycerophosphate Synthase 1 (PGS1) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phosphatidylglycerophosphate Synthase 1 (PGS1) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human PGS1 ELISA Kit

ELA-E10812h 96 Tests
EUR 824


ELI-12658b 96 Tests
EUR 928


ELI-21973h 96 Tests
EUR 824


EF002807 96 Tests
EUR 689


ELI-45023c 96 Tests
EUR 928

Mouse PGS1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PGS1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Pgs1 ELISA KIT

ELI-36283m 96 Tests
EUR 865

PGS1 Recombinant Protein (Human)

RP023263 100 ug Ask for price

PGS1 Recombinant Protein (Mouse)

RP161639 100 ug Ask for price

PGS1 ORF Vector (Human) (pORF)

ORF007755 1.0 ug DNA
EUR 95

Pgs1 ORF Vector (Mouse) (pORF)

ORF053881 1.0 ug DNA
EUR 506

pSV40- Pgs1- m (824- 1662bp)

PVT11454 2 ug
EUR 273

PGS1 ELISA Kit (Mouse) (OKEH05704)

OKEH05704 96 Wells
EUR 779
Description: Description of target: Functions in the biosynthesis of the anionic phospholipids phosphatidylglycerol and cardiolipin.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.157 ng/mL

PGS1 ELISA Kit (Bovine) (OKEH07656)

OKEH07656 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

PGS1 ELISA Kit (Chicken) (OKEH07657)

OKEH07657 96 Wells
EUR 1184
Description: Description of target: ;Species reactivity: Chicken;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.44ng/mL

PGS1 ELISA Kit (Human) (OKEH02115)

OKEH02115 96 Wells
EUR 662
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.17 ng/mL

Pgs1 sgRNA CRISPR Lentivector set (Mouse)

K4522801 3 x 1.0 ug
EUR 339

PGS1 Rabbit Polyclonal Antibody

Recent Posts


January 2022
