Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG

fallback-image

MSMB Rabbit Polyclonal Antibody

MSMB Rabbit Polyclonal Antibody

Contact us: [email protected]

MSMB Polyclonal Antibody
ABP59329-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human MSMB protein
  • Applications tips:
Description: A polyclonal antibody for detection of MSMB from Human, Mouse, Rat. This MSMB antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MSMB protein
MSMB Polyclonal Antibody
ABP59329-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human MSMB protein
  • Applications tips:
Description: A polyclonal antibody for detection of MSMB from Human, Mouse, Rat. This MSMB antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MSMB protein
MSMB Polyclonal Antibody
ES11068-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MSMB from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
MSMB Polyclonal Antibody
ES11068-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MSMB from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
Human Microseminoprotein Beta (MSMb) ELISA Kit
DLR-MSMb-Hu-48T 48T
EUR 517
  • Should the Human Microseminoprotein Beta (MSMb) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Microseminoprotein Beta (MSMb) in samples from serum, plasma, seminal plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human Microseminoprotein Beta (MSMb) ELISA Kit
DLR-MSMb-Hu-96T 96T
EUR 673
  • Should the Human Microseminoprotein Beta (MSMb) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Microseminoprotein Beta (MSMb) in samples from serum, plasma, seminal plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Mouse Microseminoprotein Beta (MSMb) ELISA Kit
DLR-MSMb-Mu-48T 48T
EUR 527
  • Should the Mouse Microseminoprotein Beta (MSMb) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Microseminoprotein Beta (MSMb) in samples from serum, plasma or other biological fluids.
Mouse Microseminoprotein Beta (MSMb) ELISA Kit
DLR-MSMb-Mu-96T 96T
EUR 688
  • Should the Mouse Microseminoprotein Beta (MSMb) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Microseminoprotein Beta (MSMb) in samples from serum, plasma or other biological fluids.
Human Microseminoprotein Beta (MSMb) ELISA Kit
RDR-MSMb-Hu-48Tests 48 Tests
EUR 544
Human Microseminoprotein Beta (MSMb) ELISA Kit
RDR-MSMb-Hu-96Tests 96 Tests
EUR 756
Mouse Microseminoprotein Beta (MSMb) ELISA Kit
RDR-MSMb-Mu-48Tests 48 Tests
EUR 557
Mouse Microseminoprotein Beta (MSMb) ELISA Kit
RDR-MSMb-Mu-96Tests 96 Tests
EUR 774
Human Microseminoprotein Beta (MSMb) ELISA Kit
RD-MSMb-Hu-48Tests 48 Tests
EUR 521
Human Microseminoprotein Beta (MSMb) ELISA Kit
RD-MSMb-Hu-96Tests 96 Tests
EUR 723
Mouse Microseminoprotein Beta (MSMb) ELISA Kit
RD-MSMb-Mu-48Tests 48 Tests
EUR 533
Mouse Microseminoprotein Beta (MSMb) ELISA Kit
RD-MSMb-Mu-96Tests 96 Tests
EUR 740
MSMB Rabbit pAb
A10092-100ul 100 ul
EUR 308
MSMB Rabbit pAb
A10092-200ul 200 ul
EUR 459
MSMB Rabbit pAb
A10092-20ul 20 ul
EUR 183
MSMB Rabbit pAb
A10092-50ul 50 ul
EUR 223
MSMB Rabbit pAb
A13625-100ul 100 ul
EUR 308
MSMB Rabbit pAb
A13625-200ul 200 ul
EUR 459
MSMB Rabbit pAb
A13625-20ul 20 ul
EUR 183
MSMB Rabbit pAb
A13625-50ul 50 ul
EUR 223
MSMB Rabbit mAb
A4168-100ul 100 ul
EUR 410
MSMB Rabbit mAb
A4168-200ul 200 ul
EUR 571
MSMB Rabbit mAb
A4168-20ul 20 ul
EUR 221
MSMB Rabbit mAb
A4168-50ul 50 ul
EUR 287
MSMB antibody
70R-18647 50 ul
EUR 435
Description: Rabbit polyclonal MSMB antibody
MSMB Antibody
32522-100ul 100ul
EUR 252
MSMB Antibody
DF6720 200ul
EUR 304
Description: MSMB Antibody detects endogenous levels of total MSMB.
MSMB Antibody
1-CSB-PA301850
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MSMB. Recognizes MSMB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200
MSMB Antibody
1-CSB-PA164416
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MSMB. Recognizes MSMB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100
MSMB Antibody
1-CSB-PA015046GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against MSMB. Recognizes MSMB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC
MSMB Antibody
1-CSB-PA015046LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MSMB. Recognizes MSMB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
MSMB Antibody
ABD6720 100 ug
EUR 438
Microseminoprotein Beta (MSMb) Polyclonal Antibody (Human)
4-PAC628Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MSMb (Asn19~Ile114)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Microseminoprotein Beta (MSMb)
Microseminoprotein Beta (MSMb) Polyclonal Antibody (Mouse)
4-PAC628Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MSMb (Val21-Met113)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Microseminoprotein Beta (MSMb)
MSMB Conjugated Antibody
C32522 100ul
EUR 397
Anti-MSMB antibody
STJ112132 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the immunoglobulin binding factor family. It is synthesized by the epithelial cells of the prostate gland and secreted into the seminal plasma. This protein has inhibin-like activity. It may have a role as an autocrine paracrine factor in uterine, breast and other female reproductive tissues. The expression of the encoded protein is found to be decreased in prostate cancer. Two alternatively spliced transcript variants encoding different isoforms are described for this gene. The use of alternate polyadenylation sites has been found for this gene.
Anti-MSMB antibody
STJ115584 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the immunoglobulin binding factor family. It is synthesized by the epithelial cells of the prostate gland and secreted into the seminal plasma. This protein has inhibin-like activity. It may have a role as an autocrine paracrine factor in uterine, breast and other female reproductive tissues. The expression of the encoded protein is found to be decreased in prostate cancer. Two alternatively spliced transcript variants encoding different isoforms are described for this gene. The use of alternate polyadenylation sites has been found for this gene.
Anti-MSMB antibody
STJ192226 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to MSMB
Msmb/ Rat Msmb ELISA Kit
ELI-07507r 96 Tests
EUR 886
Microseminoprotein Beta (MSMb) Polyclonal Antibody (Human), APC
4-PAC628Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MSMb (Asn19~Ile114)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Microseminoprotein Beta (MSMb). This antibody is labeled with APC.
Microseminoprotein Beta (MSMb) Polyclonal Antibody (Human), Biotinylated
4-PAC628Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MSMb (Asn19~Ile114)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Microseminoprotein Beta (MSMb). This antibody is labeled with Biotin.
Microseminoprotein Beta (MSMb) Polyclonal Antibody (Human), Cy3
4-PAC628Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MSMb (Asn19~Ile114)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Microseminoprotein Beta (MSMb). This antibody is labeled with Cy3.
Microseminoprotein Beta (MSMb) Polyclonal Antibody (Human), FITC
4-PAC628Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MSMb (Asn19~Ile114)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Microseminoprotein Beta (MSMb). This antibody is labeled with FITC.
Microseminoprotein Beta (MSMb) Polyclonal Antibody (Human), HRP
4-PAC628Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MSMb (Asn19~Ile114)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Microseminoprotein Beta (MSMb). This antibody is labeled with HRP.
Microseminoprotein Beta (MSMb) Polyclonal Antibody (Human), PE
4-PAC628Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MSMb (Asn19~Ile114)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Microseminoprotein Beta (MSMb). This antibody is labeled with PE.
Microseminoprotein Beta (MSMb) Polyclonal Antibody (Mouse), APC
4-PAC628Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MSMb (Val21-Met113)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Microseminoprotein Beta (MSMb). This antibody is labeled with APC.
Microseminoprotein Beta (MSMb) Polyclonal Antibody (Mouse), Biotinylated
4-PAC628Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MSMb (Val21-Met113)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Microseminoprotein Beta (MSMb). This antibody is labeled with Biotin.
Microseminoprotein Beta (MSMb) Polyclonal Antibody (Mouse), Cy3
4-PAC628Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MSMb (Val21-Met113)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Microseminoprotein Beta (MSMb). This antibody is labeled with Cy3.
Microseminoprotein Beta (MSMb) Polyclonal Antibody (Mouse), FITC
4-PAC628Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MSMb (Val21-Met113)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Microseminoprotein Beta (MSMb). This antibody is labeled with FITC.
Microseminoprotein Beta (MSMb) Polyclonal Antibody (Mouse), HRP
4-PAC628Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MSMb (Val21-Met113)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Microseminoprotein Beta (MSMb). This antibody is labeled with HRP.
Microseminoprotein Beta (MSMb) Polyclonal Antibody (Mouse), PE
4-PAC628Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MSMb (Val21-Met113)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Microseminoprotein Beta (MSMb). This antibody is labeled with PE.
Rabbit β microseminoprotein(MSMB) ELISA kit
E04B0949-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit β microseminoprotein(MSMB) ELISA kit
E04B0949-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit β microseminoprotein(MSMB) ELISA kit
E04B0949-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Microseminoprotein Beta (MSMb) ELISA Kit
abx362965-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
MSMB siRNA
20-abx903360
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
MSMB siRNA
20-abx924797
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
MSMB siRNA
20-abx924798
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
MSMB Antibody, HRP conjugated
1-CSB-PA015046LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MSMB. Recognizes MSMB from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
MSMB Antibody, FITC conjugated
1-CSB-PA015046LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MSMB. Recognizes MSMB from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
MSMB Antibody, Biotin conjugated
1-CSB-PA015046LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MSMB. Recognizes MSMB from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Microseminoprotein Beta (MSMb) Antibody
20-abx177557
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.
Microseminoprotein Beta (MSMB) Antibody
20-abx211136
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Microseminoprotein Beta (MSMB) Antibody
20-abx211250
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Microseminoprotein Beta (MSMb) Antibody
20-abx102392
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.
Microseminoprotein Beta (MSMB) Antibody
20-abx113736
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Microseminoprotein Beta (MSMb) Antibody
20-abx129875
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Microseminoprotein Beta (MSMB) Antibody
20-abx136010
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Microseminoprotein Beta (MSMb) Antibody
20-abx173566
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Microseminoprotein Beta (MSMB) Antibody
20-abx333960
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Microseminoprotein Beta (MSMB) Antibody
20-abx225295
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
Anti-MSMB Monoclonal Antibody
M03041 100ug
EUR 397
Description: Rabbit Monoclonal MSMB Antibody. Validated in IP, WB and tested in Human.
Microseminoprotein Beta (MSMb) Polyclonal Antibody (Human), APC-Cy7
4-PAC628Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MSMb (Asn19~Ile114)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Microseminoprotein Beta (MSMb). This antibody is labeled with APC-Cy7.
Microseminoprotein Beta (MSMb) Polyclonal Antibody (Mouse), APC-Cy7
4-PAC628Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MSMb (Val21-Met113)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Microseminoprotein Beta (MSMb). This antibody is labeled with APC-Cy7.
MSMB Blocking Peptide
DF6720-BP 1mg
EUR 195
MSMB cloning plasmid
CSB-CL015046HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 345
  • Sequence: atgaatgttctcctgggcagcgttgtgatctttgccaccttcgtgactttatgcaatgcatcatgctatttcatacctaatgagggagttccaggagattcaaccaggaaatgcatggatctcaaaggaaacaaacacccaataaactcggagtggcagactgacaactgtgagac
  • Show more
Description: A cloning plasmid for the MSMB gene.
Microseminoprotein Beta (MSMb) Antibody (Biotin)
20-abx272286
  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Microseminoprotein Beta (MSMB) Antibody (HRP)
20-abx334839
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Microseminoprotein Beta (MSMB) Antibody (FITC)
20-abx334840
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Microseminoprotein Beta (MSMB) Antibody (Biotin)
20-abx334841
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Microseminoprotein Beta (MSMb) Antibody Pair
20-abx370275
  • EUR 1748.00
  • EUR 1121.00
  • 10 × 96 tests
  • 5 × 96 tests
  • Shipped within 5-15 working days.
Microseminoprotein Beta (MSMb) Antibody (FITC)
20-abx273626
  • EUR 481.00
  • EUR 244.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Mouse Anti-Human MSMB Monoclonal Antibody
CAB-1906MH 0.5mg
EUR 840
Mouse Anti-Human MSMB Monoclonal Antibody
CAB-1908MH 0.5mg
EUR 840
Human MSMB ELISA Kit
ELA-E3728h 96 Tests
EUR 824
MSMB ELISA KIT|Human
EF006345 96 Tests
EUR 689
Mouse MSMB shRNA Plasmid
20-abx971579
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat MSMB shRNA Plasmid
20-abx985418
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Microseminoprotein Beta (MSMB) Protein
20-abx263042
  • EUR 328.00
  • EUR 7358.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.
Human MSMB shRNA Plasmid
20-abx952973
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Recombinant Microseminoprotein Beta (MSMb)
4-RPC628Hu01
  • EUR 458.40
  • EUR 226.00
  • EUR 1444.00
  • EUR 548.00
  • EUR 996.00
  • EUR 370.00
  • EUR 3460.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P08118
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 16.7kDa
  • Isoelectric Point: 5.6
Description: Recombinant Human Microseminoprotein Beta expressed in: E.coli
Recombinant Microseminoprotein Beta (MSMb)
4-RPC628Mu01
  • EUR 499.62
  • EUR 236.00
  • EUR 1598.56
  • EUR 599.52
  • EUR 1099.04
  • EUR 397.00
  • EUR 3846.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O08540
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 40.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Microseminoprotein Beta expressed in: E.coli
MSMB Recombinant Protein (Human)
RP020176 100 ug Ask for price
MSMB Recombinant Protein (Mouse)
RP151835 100 ug Ask for price
MSMB Recombinant Protein (Rat)
RP212564 100 ug Ask for price

MSMB Rabbit Polyclonal Antibody

Recent Posts

Categories

January 2022
M T W T F S S
 12
3456789
10111213141516
17181920212223
24252627282930
31  

Pages