DEF6 Rabbit Polyclonal Antibody
Contact us: [email protected]
 DEF6 Polyclonal Antibody |
|
ABP58351-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human DEF6 protein at amino acid sequence of 51-100
- Applications tips:
|
|
Description: A polyclonal antibody for detection of DEF6 from Human. This DEF6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DEF6 protein at amino acid sequence of 51-100 |
DEF6 Polyclonal Antibody |
|
ES11449-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against DEF6 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
DEF6 Polyclonal Antibody |
|
ES11449-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against DEF6 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
 DEF6 Rabbit pAb |
|
A14337-100ul |
Abclonal |
100 ul |
EUR 308 |
DEF6 Rabbit pAb |
|
A14337-200ul |
Abclonal |
200 ul |
EUR 459 |
DEF6 Rabbit pAb |
|
A14337-20ul |
Abclonal |
20 ul |
EUR 183 |
DEF6 Rabbit pAb |
|
A14337-50ul |
Abclonal |
50 ul |
EUR 223 |
 DEF6 Polyclonal Conjugated Antibody |
|
C28514 |
SAB |
100ul |
EUR 397 |
 DEF6 antibody |
|
70R-16799 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal DEF6 antibody |
 DEF6 Antibody |
|
1-CSB-PA884467LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against DEF6. Recognizes DEF6 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200 |
DEF6 Antibody |
|
1-CSB-PA006650GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against DEF6. Recognizes DEF6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC |
) Polyclonal DEF6 Antibody (C-term) |
|
APR15716G |
Leading Biology |
0.1ml |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DEF6 (C-term). This antibody is tested and proven to work in the following applications: |
 Polyclonal Goat Anti-IBP / DEF6 Antibody |
|
APR16306G |
Leading Biology |
0.1 mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-IBP / DEF6 . This antibody is tested and proven to work in the following applications: |
 anti- DEF6 antibody |
|
FNab02325 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: differentially expressed in FDCP 6 homolog(Mouse)
- Uniprot ID: Q9H4E7
- Gene ID: 50619
- Research Area: Signal Transduction, Immunology
|
|
Description: Antibody raised against DEF6 |
 Anti-DEF6 antibody |
|
STJ192607 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to DEF6 |
 DEF6 siRNA |
|
20-abx913851 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DEF6 siRNA |
|
20-abx913852 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-DEF6 |
|
YF-PA18744 |
Abfrontier |
50 ul |
EUR 363 |
|
Description: Mouse polyclonal to DEF6 |
 DEF6 Antibody, HRP conjugated |
|
1-CSB-PA884467LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against DEF6. Recognizes DEF6 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 DEF6 Antibody, FITC conjugated |
|
1-CSB-PA884467LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against DEF6. Recognizes DEF6 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 DEF6 Antibody, Biotin conjugated |
|
1-CSB-PA884467LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against DEF6. Recognizes DEF6 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 DEF6 cloning plasmid |
|
CSB-CL884467HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1011
- Sequence: atggccctgcgcaaggaactgctcaagtccatctggtacgcctttaccgcgctggacgtggagaagagtggcaaagtctccaagtcccagctcaaggtgctgtcccacaacctgtacacggtcctgcacatcccccatgaccccgtggccctggaggaacacttccgagatgatg
- Show more
|
|
Description: A cloning plasmid for the DEF6 gene. |
) Anti-DEF6 (1F2) |
|
YF-MA11482 |
Abfrontier |
50 ug |
EUR 363 |
|
Description: Mouse monoclonal to DEF6 |
) Anti-DEF6 (1F2) |
|
YF-MA20251 |
Abfrontier |
200 ul |
EUR 363 |
|
Description: Mouse monoclonal to DEF6 |
DEF6 Rabbit Polyclonal Antibody
