Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG

fallback-image

DEF6 Rabbit Polyclonal Antibody

DEF6 Rabbit Polyclonal Antibody

Contact us: [email protected]

DEF6 Polyclonal Antibody

ABP58351-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human DEF6 protein at amino acid sequence of 51-100
  • Applications tips:
Description: A polyclonal antibody for detection of DEF6 from Human. This DEF6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DEF6 protein at amino acid sequence of 51-100

DEF6 Polyclonal Antibody

ES11449-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against DEF6 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

DEF6 Polyclonal Antibody

ES11449-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against DEF6 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

DEF6 Rabbit pAb

A14337-100ul 100 ul
EUR 308

DEF6 Rabbit pAb

A14337-200ul 200 ul
EUR 459

DEF6 Rabbit pAb

A14337-20ul 20 ul
EUR 183

DEF6 Rabbit pAb

A14337-50ul 50 ul
EUR 223

DEF6 Polyclonal Conjugated Antibody

C28514 100ul
EUR 397

DEF6 antibody

70R-16799 50 ul
EUR 435
Description: Rabbit polyclonal DEF6 antibody

DEF6 Antibody

1-CSB-PA884467LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DEF6. Recognizes DEF6 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200

DEF6 Antibody

1-CSB-PA006650GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against DEF6. Recognizes DEF6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

Polyclonal DEF6 Antibody (C-term)

APR15716G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DEF6 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal Goat Anti-IBP / DEF6 Antibody

APR16306G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-IBP / DEF6 . This antibody is tested and proven to work in the following applications:

anti- DEF6 antibody

FNab02325 100µg
EUR 505.25
  • Immunogen: differentially expressed in FDCP 6 homolog(Mouse)
  • Uniprot ID: Q9H4E7
  • Gene ID: 50619
  • Research Area: Signal Transduction, Immunology
Description: Antibody raised against DEF6

Anti-DEF6 antibody

PAab02325 100 ug
EUR 355

Anti-DEF6 antibody

STJ116549 100 µl
EUR 277

Anti-DEF6 antibody

STJ192607 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to DEF6

DEF6 siRNA

20-abx913851
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DEF6 siRNA

20-abx913852
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-DEF6

YF-PA18744 50 ul
EUR 363
Description: Mouse polyclonal to DEF6

DEF6 Antibody, HRP conjugated

1-CSB-PA884467LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DEF6. Recognizes DEF6 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

DEF6 Antibody, FITC conjugated

1-CSB-PA884467LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DEF6. Recognizes DEF6 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

DEF6 Antibody, Biotin conjugated

1-CSB-PA884467LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DEF6. Recognizes DEF6 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-IBP / DEF6 antibody

STJ70543 100 µg
EUR 359

DEF6 cloning plasmid

CSB-CL884467HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1011
  • Sequence: atggccctgcgcaaggaactgctcaagtccatctggtacgcctttaccgcgctggacgtggagaagagtggcaaagtctccaagtcccagctcaaggtgctgtcccacaacctgtacacggtcctgcacatcccccatgaccccgtggccctggaggaacacttccgagatgatg
  • Show more
Description: A cloning plasmid for the DEF6 gene.

Anti-DEF6 (1F2)

YF-MA11482 50 ug
EUR 363
Description: Mouse monoclonal to DEF6

Anti-DEF6 (1F2)

YF-MA20251 200 ul
EUR 363
Description: Mouse monoclonal to DEF6

DEF6 Rabbit Polyclonal Antibody

Recent Posts

Categories

January 2022
M T W T F S S
 12
3456789
10111213141516
17181920212223
24252627282930
31  

Pages