Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG

fallback-image

SLPI Rabbit Polyclonal Antibody

SLPI Rabbit Polyclonal Antibody

Contact us: [email protected]

SLPI Polyclonal Antibody

ABP60433-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human SLPI protein
  • Applications tips:
Description: A polyclonal antibody for detection of SLPI from Human, Mouse. This SLPI antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SLPI protein

SLPI Polyclonal Antibody

ABP60433-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human SLPI protein
  • Applications tips:
Description: A polyclonal antibody for detection of SLPI from Human, Mouse. This SLPI antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SLPI protein

SLPI Polyclonal Antibody

ES11078-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against SLPI from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

SLPI Polyclonal Antibody

ES11078-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against SLPI from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

SLPI Rabbit pAb

A1897-100ul 100 ul
EUR 308

SLPI Rabbit pAb

A1897-200ul 200 ul
EUR 459

SLPI Rabbit pAb

A1897-20ul 20 ul
EUR 183

SLPI Rabbit pAb

A1897-50ul 50 ul
EUR 223

Human Secretory Leukocyte Peptidase Inhibitor (SLPI) ELISA Kit

DLR-SLPI-Hu-48T 48T
EUR 498
  • Should the Human Secretory Leukocyte Peptidase Inhibitor (SLPI) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Secretory Leukocyte Peptidase Inhibitor (SLPI) in samples from serum, plasma or other biological fluids.

Human Secretory Leukocyte Peptidase Inhibitor (SLPI) ELISA Kit

DLR-SLPI-Hu-96T 96T
EUR 647
  • Should the Human Secretory Leukocyte Peptidase Inhibitor (SLPI) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Secretory Leukocyte Peptidase Inhibitor (SLPI) in samples from serum, plasma or other biological fluids.

Mouse Secretory Leukocyte Peptidase Inhibitor (SLPI) ELISA Kit

DLR-SLPI-Mu-48T 48T
EUR 508
  • Should the Mouse Secretory Leukocyte Peptidase Inhibitor (SLPI) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Secretory Leukocyte Peptidase Inhibitor (SLPI) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Secretory Leukocyte Peptidase Inhibitor (SLPI) ELISA Kit

DLR-SLPI-Mu-96T 96T
EUR 661
  • Should the Mouse Secretory Leukocyte Peptidase Inhibitor (SLPI) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Secretory Leukocyte Peptidase Inhibitor (SLPI) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Secretory Leukocyte Peptidase Inhibitor (SLPI) ELISA Kit

RD-SLPI-Hu-48Tests 48 Tests
EUR 500

Human Secretory Leukocyte Peptidase Inhibitor (SLPI) ELISA Kit

RD-SLPI-Hu-96Tests 96 Tests
EUR 692

Mouse Secretory Leukocyte Peptidase Inhibitor (SLPI) ELISA Kit

RD-SLPI-Mu-48Tests 48 Tests
EUR 511

Mouse Secretory Leukocyte Peptidase Inhibitor (SLPI) ELISA Kit

RD-SLPI-Mu-96Tests 96 Tests
EUR 709

Human Secretory Leukocyte Peptidase Inhibitor (SLPI) ELISA Kit

RDR-SLPI-Hu-48Tests 48 Tests
EUR 522

Human Secretory Leukocyte Peptidase Inhibitor (SLPI) ELISA Kit

RDR-SLPI-Hu-96Tests 96 Tests
EUR 724

Mouse Secretory Leukocyte Peptidase Inhibitor (SLPI) ELISA Kit

RDR-SLPI-Mu-48Tests 48 Tests
EUR 534

Mouse Secretory Leukocyte Peptidase Inhibitor (SLPI) ELISA Kit

RDR-SLPI-Mu-96Tests 96 Tests
EUR 742

Rabbit SLPI ELISA Kit

ERTS0123 96Tests
EUR 521

SLPI Polyclonal Antibody, HRP Conjugated

A51963 100 µg
EUR 570.55
Description: Ask the seller for details

SLPI Polyclonal Antibody, FITC Conjugated

A51964 100 µg
EUR 570.55
Description: The best epigenetics products

SLPI Polyclonal Antibody, Biotin Conjugated

A51965 100 µg
EUR 570.55
Description: kits suitable for this type of research

SLPI Antibody

24542-100ul 100ul
EUR 390

SLPI Antibody

24543-100ul 100ul
EUR 390

SLPI antibody

70R-15411 100 ug
EUR 327
Description: Rabbit polyclonal SLPI antibody

SLPI antibody

38316-100ul 100ul
EUR 252

SLPI Antibody

1-CSB-PA07154A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLPI. Recognizes SLPI from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

SLPI antibody

70R-9706 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal SLPI antibody

SLPI antibody (HRP)

60R-2044 100 ug
EUR 327
Description: Rabbit polyclonal SLPI antibody (HRP)

SLPI antibody (FITC)

60R-2045 100 ug
EUR 327
Description: Rabbit polyclonal SLPI antibody (FITC)

SLPI antibody (biotin)

60R-2046 100 ug
EUR 327
Description: Rabbit polyclonal SLPI antibody (biotin)

Anti-SLPI Antibody

A01682-1 100ug/vial
EUR 334

Antileukoproteinase (SLPI) Antibody

20-abx109544
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

SLPI Conjugated Antibody

C38316 100ul
EUR 397

Anti-SLPI antibody

STJ11100591 100 µl
EUR 277
Description: This gene encodes a secreted inhibitor which protects epithelial tissues from serine proteases. It is found in various secretions including seminal plasma, cervical mucus, and bronchial secretions, and has affinity for trypsin, leukocyte elastase, and cathepsin G. Its inhibitory effect contributes to the immune response by protecting epithelial surfaces from attack by endogenous proteolytic enzymes. This antimicrobial protein has antibacterial, antifungal and antiviral activity.

Anti-SLPI antibody

STJ16100138 100 µg
EUR 899

Anti-SLPI antibody

STJ16100139 50 µg
EUR 704

Anti-SLPI antibody

STJ192236 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SLPI

SLPI siRNA

20-abx934267
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SLPI siRNA

20-abx934268
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-SLPI

YF-PA24724 50 ul
EUR 334
Description: Mouse polyclonal to SLPI

anti-SLPI

YF-PA27362 50 ug
EUR 363
Description: Mouse polyclonal to SLPI

SLPI Antibody, HRP conjugated

1-CSB-PA07154B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLPI. Recognizes SLPI from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SLPI Antibody, FITC conjugated

1-CSB-PA07154C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLPI. Recognizes SLPI from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SLPI Antibody, Biotin conjugated

1-CSB-PA07154D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLPI. Recognizes SLPI from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Secretory Leukocyte Peptidase Inhibitor (SLPI) Polyclonal Antibody (Mouse)

4-PAB312Mu01
  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SLPI (Pro20~Met131)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Secretory Leukocyte Peptidase Inhibitor (SLPI)

SLPI cloning plasmid

CSB-CL021781HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 399
  • Sequence: atgaagtccagcggcctcttccccttcctggtgctgcttgccctgggaactctggcaccttgggctgtggaaggctctggaaagtccttcaaagctggagtctgtcctcctaagaaatctgcccagtgccttagatacaagaaacctgagtgccagagtgactggcagtgtccagg
  • Show more
Description: A cloning plasmid for the SLPI gene.

Anti-SLPI (3C6)

YF-MA15457 100 ug
EUR 363
Description: Mouse monoclonal to SLPI

Secretory Leukocyte Peptidase Inhibitor (SLPI) Polyclonal Antibody (Mouse), APC

4-PAB312Mu01-APC
  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SLPI (Pro20~Met131)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Secretory Leukocyte Peptidase Inhibitor (SLPI). This antibody is labeled with APC.

Secretory Leukocyte Peptidase Inhibitor (SLPI) Polyclonal Antibody (Mouse), Biotinylated

4-PAB312Mu01-Biotin
  • EUR 307.00
  • EUR 2407.00
  • EUR 714.00
  • EUR 375.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SLPI (Pro20~Met131)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Secretory Leukocyte Peptidase Inhibitor (SLPI). This antibody is labeled with Biotin.

Secretory Leukocyte Peptidase Inhibitor (SLPI) Polyclonal Antibody (Mouse), Cy3

4-PAB312Mu01-Cy3
  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SLPI (Pro20~Met131)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Secretory Leukocyte Peptidase Inhibitor (SLPI). This antibody is labeled with Cy3.

Secretory Leukocyte Peptidase Inhibitor (SLPI) Polyclonal Antibody (Mouse), FITC

4-PAB312Mu01-FITC
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SLPI (Pro20~Met131)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Secretory Leukocyte Peptidase Inhibitor (SLPI). This antibody is labeled with FITC.

Secretory Leukocyte Peptidase Inhibitor (SLPI) Polyclonal Antibody (Mouse), HRP

4-PAB312Mu01-HRP
  • EUR 311.00
  • EUR 2792.00
  • EUR 791.00
  • EUR 391.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SLPI (Pro20~Met131)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Secretory Leukocyte Peptidase Inhibitor (SLPI). This antibody is labeled with HRP.

Secretory Leukocyte Peptidase Inhibitor (SLPI) Polyclonal Antibody (Mouse), PE

4-PAB312Mu01-PE
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SLPI (Pro20~Met131)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Secretory Leukocyte Peptidase Inhibitor (SLPI). This antibody is labeled with PE.

Rabbit Secretory Leukocyte Peptidase Inhibitor (SLPI) ELISA Kit

abx363252-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Secretory Leukocyte Peptidase Inhibitor (SLPI) Polyclonal Antibody (Mouse), APC-Cy7

4-PAB312Mu01-APC-Cy7
  • EUR 560.00
  • EUR 6286.00
  • EUR 1669.00
  • EUR 745.00
  • EUR 315.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SLPI (Pro20~Met131)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Secretory Leukocyte Peptidase Inhibitor (SLPI). This antibody is labeled with APC-Cy7.

Secretory Leukocyte Peptidase Inhibitor (SLPI) Antibody

20-abx178335
  • EUR 1149.00
  • EUR 565.00
  • 1 mg
  • 200 ug
  • Please enquire.

Secretory Leukocyte Peptidase Inhibitor (SLPI) Antibody

20-abx178336
  • EUR 1177.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Secretory Leukocyte Peptidase Inhibitor (SLPI) Antibody

20-abx104088
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Secretory Leukocyte Peptidase Inhibitor (SLPI) Antibody

20-abx174486
  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.

Secretory Leukocyte Protease Inhibitor (SLPI) Antibody

abx411960-01mg 0.1 mg
EUR 509
  • Shipped within 1 week.

SLPI protein (His tag)

80R-1362 50 ug
EUR 397
Description: Purified recombinant Human SLPI protein

Human SLPI ELISA Kit

ELA-E1312h 96 Tests
EUR 824

Human SLPI ELISA Kit

EHS0123 96Tests
EUR 521

Bovine SLPI ELISA Kit

EBS0123 96Tests
EUR 521

Anserini SLPI ELISA Kit

EAS0123 96Tests
EUR 521

Chicken SLPI ELISA Kit

ECKS0123 96Tests
EUR 521

Canine SLPI ELISA Kit

ECS0123 96Tests
EUR 521

Goat SLPI ELISA Kit

EGTS0123 96Tests
EUR 521

SLPI ELISA KIT|Human

EF000380 96 Tests
EUR 689

Mouse SLPI shRNA Plasmid

20-abx972769
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human SLPI shRNA Plasmid

20-abx954476
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Porcine SLPI ELISA Kit

EPS0123 96Tests
EUR 521

Sheep SLPI ELISA Kit

ESS0123 96Tests
EUR 521

Rat SLPI ELISA Kit

ERS0123 96Tests
EUR 521

Monkey SLPI ELISA Kit

EMKS0123 96Tests
EUR 521

Mouse SLPI ELISA Kit

EMS0123 96Tests
EUR 521

SLPI Recombinant Protein (Rat)

RP229982 100 ug Ask for price

SLPI Recombinant Protein (Human)

RP029323 100 ug Ask for price

SLPI Recombinant Protein (Mouse)

RP173741 100 ug Ask for price

Secretory Leukocyte Protease Inhibitor (SLPI) Antibody Pair

abx117629-1pair5x96wellplates 1 pair (5x96 well plates)
EUR 1010
  • Shipped within 5-10 working days.

Secretory Leukocyte Peptidase Inhibitor (SLPI) Antibody (Biotin)

20-abx272778
  • EUR 453.00
  • EUR 244.00
  • EUR 1288.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Secretory Leukocyte Peptidase Inhibitor (SLPI) Antibody Pair

20-abx370266
  • EUR 1706.00
  • EUR 1094.00
  • 10 × 96 tests
  • 5 × 96 tests
  • Shipped within 5-15 working days.

Secretory Leukocyte Peptidase Inhibitor (SLPI) Antibody (FITC)

20-abx273938
  • EUR 467.00
  • EUR 244.00
  • EUR 1386.00
  • EUR 648.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse SLPI PicoKine ELISA Kit

EK1996 96 wells
EUR 425
Description: For quantitative detection of mouse SLPI in cell culture supernates, serum and plasma (heparin, EDTA).

Guinea Pig SLPI ELISA Kit

EGS0123 96Tests
EUR 521

Human SLPI/ Antileukoproteinase ELISA Kit

E2340Hu 1 Kit
EUR 537

Mouse Antileukoproteinase, Slpi ELISA KIT

ELI-04340m 96 Tests
EUR 865

Human Antileukoproteinase, SLPI ELISA KIT

ELI-04341h 96 Tests
EUR 824

Porcine Antileukoproteinase, SLPI ELISA KIT

ELI-04342p 96 Tests
EUR 928

Slpi ORF Vector (Rat) (pORF)

ORF076662 1.0 ug DNA
EUR 506

SLPI ORF Vector (Human) (pORF)

ORF009775 1.0 ug DNA
EUR 95

Slpi ORF Vector (Mouse) (pORF)

ORF057915 1.0 ug DNA
EUR 506

SLPI ELISA Kit (Mouse) (OKAN05921)

OKAN05921 96 Wells
EUR 792
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.3 pg/mL

SLPI Rabbit Polyclonal Antibody

Recent Posts

Categories

January 2022
M T W T F S S
 12
3456789
10111213141516
17181920212223
24252627282930
31  

Pages