Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG

fallback-image

FETUB Rabbit Polyclonal Antibody

FETUB Rabbit Polyclonal Antibody

Contact us: [email protected]

FETUB Polyclonal Antibody

ABP58544-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human FETUB protein at amino acid sequence of 220-300
  • Applications tips:
Description: A polyclonal antibody for detection of FETUB from Human, Mouse, Rat. This FETUB antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FETUB protein at amino acid sequence of 220-300

FETUB Polyclonal Antibody

ES11176-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against FETUB from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

FETUB Polyclonal Antibody

ES11176-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against FETUB from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Bovine Fetuin B (FETUB) ELISA Kit

DLR-FETUB-b-48T 48T
EUR 569
  • Should the Bovine Fetuin B (FETUB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Bovine Fetuin B (FETUB) in samples from serum, plasma or other biological fluids.

Bovine Fetuin B (FETUB) ELISA Kit

DLR-FETUB-b-96T 96T
EUR 746
  • Should the Bovine Fetuin B (FETUB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Bovine Fetuin B (FETUB) in samples from serum, plasma or other biological fluids.

Human Fetuin B (FETUB) ELISA Kit

DLR-FETUB-Hu-48T 48T
EUR 498
  • Should the Human Fetuin B (FETUB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Fetuin B (FETUB) in samples from serum, plasma or other biological fluids.

Human Fetuin B (FETUB) ELISA Kit

DLR-FETUB-Hu-96T 96T
EUR 647
  • Should the Human Fetuin B (FETUB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Fetuin B (FETUB) in samples from serum, plasma or other biological fluids.

Rat Fetuin B (FETUB) ELISA Kit

DLR-FETUB-Ra-48T 48T
EUR 528
  • Should the Rat Fetuin B (FETUB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Fetuin B (FETUB) in samples from serum, plasma or other biological fluids.

Rat Fetuin B (FETUB) ELISA Kit

DLR-FETUB-Ra-96T 96T
EUR 690
  • Should the Rat Fetuin B (FETUB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Fetuin B (FETUB) in samples from serum, plasma or other biological fluids.

Bovine Fetuin B (FETUB) ELISA Kit

RDR-FETUB-b-48Tests 48 Tests
EUR 607

Bovine Fetuin B (FETUB) ELISA Kit

RDR-FETUB-b-96Tests 96 Tests
EUR 845

Human Fetuin B (FETUB) ELISA Kit

RDR-FETUB-Hu-48Tests 48 Tests
EUR 522

Human Fetuin B (FETUB) ELISA Kit

RDR-FETUB-Hu-96Tests 96 Tests
EUR 724

Rat Fetuin B (FETUB) ELISA Kit

RDR-FETUB-Ra-48Tests 48 Tests
EUR 558

Rat Fetuin B (FETUB) ELISA Kit

RDR-FETUB-Ra-96Tests 96 Tests
EUR 776

Bovine Fetuin B (FETUB) ELISA Kit

RD-FETUB-b-48Tests 48 Tests
EUR 580

Bovine Fetuin B (FETUB) ELISA Kit

RD-FETUB-b-96Tests 96 Tests
EUR 807

Human Fetuin B (FETUB) ELISA Kit

RD-FETUB-Hu-48Tests 48 Tests
EUR 500

Human Fetuin B (FETUB) ELISA Kit

RD-FETUB-Hu-96Tests 96 Tests
EUR 692

Rat Fetuin B (FETUB) ELISA Kit

RD-FETUB-Ra-48Tests 48 Tests
EUR 534

Rat Fetuin B (FETUB) ELISA Kit

RD-FETUB-Ra-96Tests 96 Tests
EUR 742

FETUB Antibody

36475-100ul 100ul
EUR 252

FETUB Antibody

1-CSB-PA218023
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FETUB. Recognizes FETUB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

FETUB antibody

70R-5424 50 ug
EUR 467
Description: Rabbit polyclonal FETUB antibody raised against the N terminal of FETUB

FETUB Antibody

1-CSB-PA008598GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against FETUB. Recognizes FETUB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

Fetuin B (FETUB) Polyclonal Antibody (Human)

4-PAB860Hu01
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FETUB (Met149~Asp255)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fetuin B (FETUB)

Fetuin B (FETUB) Polyclonal Antibody (Mouse)

4-PAB860Mu01
  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FETUB (Phe179~Thr295)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Fetuin B (FETUB)

Fetuin B (FETUB) Polyclonal Antibody (Rat)

4-PAB860Ra01
  • EUR 251.00
  • EUR 2589.00
  • EUR 643.00
  • EUR 317.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FETUB (Ser152~Glu261)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Fetuin B (FETUB)

Fetuin B (FETUB) Polyclonal Antibody (Rat)

4-PAB860Ra02
  • EUR 251.00
  • EUR 2589.00
  • EUR 643.00
  • EUR 317.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FETUB (Asn28~Thr141)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Fetuin B (FETUB)

FETUB Conjugated Antibody

C36475 100ul
EUR 397

Anti-FETUB antibody

STJ192334 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to FETUB

Fetub/ Rat Fetub ELISA Kit

ELI-09665r 96 Tests
EUR 886

Fetuin B (FETUB) Polyclonal Antibody (Human), APC

4-PAB860Hu01-APC
  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FETUB (Met149~Asp255)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fetuin B (FETUB). This antibody is labeled with APC.

Fetuin B (FETUB) Polyclonal Antibody (Human), Biotinylated

4-PAB860Hu01-Biotin
  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FETUB (Met149~Asp255)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fetuin B (FETUB). This antibody is labeled with Biotin.

Fetuin B (FETUB) Polyclonal Antibody (Human), Cy3

4-PAB860Hu01-Cy3
  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FETUB (Met149~Asp255)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fetuin B (FETUB). This antibody is labeled with Cy3.

Fetuin B (FETUB) Polyclonal Antibody (Human), FITC

4-PAB860Hu01-FITC
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FETUB (Met149~Asp255)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fetuin B (FETUB). This antibody is labeled with FITC.

Fetuin B (FETUB) Polyclonal Antibody (Human), HRP

4-PAB860Hu01-HRP
  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FETUB (Met149~Asp255)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fetuin B (FETUB). This antibody is labeled with HRP.

Fetuin B (FETUB) Polyclonal Antibody (Human), PE

4-PAB860Hu01-PE
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FETUB (Met149~Asp255)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fetuin B (FETUB). This antibody is labeled with PE.

Fetuin B (FETUB) Polyclonal Antibody (Mouse), APC

4-PAB860Mu01-APC
  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FETUB (Phe179~Thr295)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Fetuin B (FETUB). This antibody is labeled with APC.

Fetuin B (FETUB) Polyclonal Antibody (Mouse), Biotinylated

4-PAB860Mu01-Biotin
  • EUR 307.00
  • EUR 2407.00
  • EUR 714.00
  • EUR 375.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FETUB (Phe179~Thr295)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Fetuin B (FETUB). This antibody is labeled with Biotin.

Fetuin B (FETUB) Polyclonal Antibody (Mouse), Cy3

4-PAB860Mu01-Cy3
  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FETUB (Phe179~Thr295)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Fetuin B (FETUB). This antibody is labeled with Cy3.

Fetuin B (FETUB) Polyclonal Antibody (Mouse), FITC

4-PAB860Mu01-FITC
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FETUB (Phe179~Thr295)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Fetuin B (FETUB). This antibody is labeled with FITC.

Fetuin B (FETUB) Polyclonal Antibody (Mouse), HRP

4-PAB860Mu01-HRP
  • EUR 311.00
  • EUR 2792.00
  • EUR 791.00
  • EUR 391.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FETUB (Phe179~Thr295)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Fetuin B (FETUB). This antibody is labeled with HRP.

Fetuin B (FETUB) Polyclonal Antibody (Mouse), PE

4-PAB860Mu01-PE
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FETUB (Phe179~Thr295)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Fetuin B (FETUB). This antibody is labeled with PE.

Fetuin B (FETUB) Polyclonal Antibody (Rat), APC

4-PAB860Ra01-APC
  • EUR 352.00
  • EUR 3383.00
  • EUR 939.00
  • EUR 450.00
  • EUR 223.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FETUB (Ser152~Glu261)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Fetuin B (FETUB). This antibody is labeled with APC.

Fetuin B (FETUB) Polyclonal Antibody (Rat), Biotinylated

4-PAB860Ra01-Biotin
  • EUR 316.00
  • EUR 2539.00
  • EUR 747.00
  • EUR 388.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FETUB (Ser152~Glu261)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Fetuin B (FETUB). This antibody is labeled with Biotin.

Fetuin B (FETUB) Polyclonal Antibody (Rat), Cy3

4-PAB860Ra01-Cy3
  • EUR 428.00
  • EUR 4469.00
  • EUR 1211.00
  • EUR 559.00
  • EUR 255.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FETUB (Ser152~Glu261)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Fetuin B (FETUB). This antibody is labeled with Cy3.

Fetuin B (FETUB) Polyclonal Antibody (Rat), FITC

4-PAB860Ra01-FITC
  • EUR 302.00
  • EUR 2726.00
  • EUR 771.00
  • EUR 380.00
  • EUR 198.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FETUB (Ser152~Glu261)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Fetuin B (FETUB). This antibody is labeled with FITC.

Fetuin B (FETUB) Polyclonal Antibody (Rat), HRP

4-PAB860Ra01-HRP
  • EUR 322.00
  • EUR 2948.00
  • EUR 830.00
  • EUR 407.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FETUB (Ser152~Glu261)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Fetuin B (FETUB). This antibody is labeled with HRP.

Fetuin B (FETUB) Polyclonal Antibody (Rat), PE

4-PAB860Ra01-PE
  • EUR 302.00
  • EUR 2726.00
  • EUR 771.00
  • EUR 380.00
  • EUR 198.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FETUB (Ser152~Glu261)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Fetuin B (FETUB). This antibody is labeled with PE.

Fetuin B (FETUB) Polyclonal Antibody (Rat), APC

4-PAB860Ra02-APC
  • EUR 352.00
  • EUR 3383.00
  • EUR 939.00
  • EUR 450.00
  • EUR 223.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FETUB (Asn28~Thr141)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Fetuin B (FETUB). This antibody is labeled with APC.

Fetuin B (FETUB) Polyclonal Antibody (Rat), Biotinylated

4-PAB860Ra02-Biotin
  • EUR 316.00
  • EUR 2539.00
  • EUR 747.00
  • EUR 388.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FETUB (Asn28~Thr141)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Fetuin B (FETUB). This antibody is labeled with Biotin.

Fetuin B (FETUB) Polyclonal Antibody (Rat), Cy3

4-PAB860Ra02-Cy3
  • EUR 428.00
  • EUR 4469.00
  • EUR 1211.00
  • EUR 559.00
  • EUR 255.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FETUB (Asn28~Thr141)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Fetuin B (FETUB). This antibody is labeled with Cy3.

Fetuin B (FETUB) Polyclonal Antibody (Rat), FITC

4-PAB860Ra02-FITC
  • EUR 302.00
  • EUR 2726.00
  • EUR 771.00
  • EUR 380.00
  • EUR 198.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FETUB (Asn28~Thr141)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Fetuin B (FETUB). This antibody is labeled with FITC.

Fetuin B (FETUB) Polyclonal Antibody (Rat), HRP

4-PAB860Ra02-HRP
  • EUR 322.00
  • EUR 2948.00
  • EUR 830.00
  • EUR 407.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FETUB (Asn28~Thr141)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Fetuin B (FETUB). This antibody is labeled with HRP.

Fetuin B (FETUB) Polyclonal Antibody (Rat), PE

4-PAB860Ra02-PE
  • EUR 302.00
  • EUR 2726.00
  • EUR 771.00
  • EUR 380.00
  • EUR 198.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FETUB (Asn28~Thr141)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Fetuin B (FETUB). This antibody is labeled with PE.

Rabbit Fetuin B (FETUB) ELISA Kit

abx363323-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

FETUB siRNA

20-abx901933
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FETUB siRNA

20-abx916763
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FETUB siRNA

20-abx916764
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Fetuin B (FETUB) Antibody

abx027908-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Fetuin B (FETUB) Antibody

abx027908-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Fetuin B (FETUB) Antibody

20-abx176385
  • EUR 1358.00
  • EUR 648.00
  • 1 mg
  • 200 ug
  • Please enquire.

Fetuin B (FETUB) Antibody

20-abx211322
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fetuin B (FETUB) Antibody

20-abx100323
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Fetuin B (FETUB) Antibody

20-abx100324
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Fetuin B (FETUB) Antibody

20-abx100325
  • EUR 439.00
  • EUR 133.00
  • EUR 1247.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Fetuin B (FETUB) Antibody

20-abx100326
  • EUR 439.00
  • EUR 133.00
  • EUR 1247.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Fetuin B (FETUB) Antibody

20-abx112518
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fetuin B (FETUB) Antibody

20-abx172370
  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.

Fetuin B (FETUB) Antibody

20-abx172371
  • EUR 940.00
  • EUR 481.00
  • 1 mg
  • 200 ug
  • Please enquire.

Fetuin-B (FETUB) Antibody

abx233082-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Fetuin B (FETUB) Polyclonal Antibody (Human), APC-Cy7

4-PAB860Hu01-APC-Cy7
  • EUR 547.00
  • EUR 6106.00
  • EUR 1624.00
  • EUR 727.00
  • EUR 310.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FETUB (Met149~Asp255)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fetuin B (FETUB). This antibody is labeled with APC-Cy7.

Fetuin B (FETUB) Polyclonal Antibody (Mouse), APC-Cy7

4-PAB860Mu01-APC-Cy7
  • EUR 560.00
  • EUR 6286.00
  • EUR 1669.00
  • EUR 745.00
  • EUR 315.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FETUB (Phe179~Thr295)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Fetuin B (FETUB). This antibody is labeled with APC-Cy7.

Fetuin B (FETUB) Polyclonal Antibody (Rat), APC-Cy7

4-PAB860Ra01-APC-Cy7
  • EUR 585.00
  • EUR 6646.00
  • EUR 1759.00
  • EUR 781.00
  • EUR 326.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FETUB (Ser152~Glu261)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Fetuin B (FETUB). This antibody is labeled with APC-Cy7.

Fetuin B (FETUB) Polyclonal Antibody (Rat), APC-Cy7

4-PAB860Ra02-APC-Cy7
  • EUR 585.00
  • EUR 6646.00
  • EUR 1759.00
  • EUR 781.00
  • EUR 326.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FETUB (Asn28~Thr141)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Fetuin B (FETUB). This antibody is labeled with APC-Cy7.

FETUB Blocking Peptide

33R-3189 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FETUB antibody, catalog no. 70R-5424

FETUB cloning plasmid

CSB-CL890680HU-10ug 10ug
EUR 432
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1149
  • Sequence: atgggtctgctccttcccctggcactctgcatcctagtcctgtgctgcggagcaatgtctccaccccagctggccctcaacccctcggctctgctctcccggggctgcaatgactcagatgtgctggcagttgcaggctttgccctgcgggatattaacaaagacagaaaggatg
  • Show more
Description: A cloning plasmid for the FETUB gene.

Fetuin B (FETUB) Antibody (FITC)

20-abx271045
  • EUR 467.00
  • EUR 244.00
  • EUR 1358.00
  • EUR 648.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Fetuin B (FETUB) Antibody (Biotin)

20-abx271308
  • EUR 439.00
  • EUR 244.00
  • EUR 1261.00
  • EUR 606.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Fetuin B (FETUB) Antibody (Biotin)

20-abx272945
  • EUR 467.00
  • EUR 244.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Fetuin B (FETUB) Antibody (Biotin)

20-abx273270
  • EUR 467.00
  • EUR 244.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Rat Fetuin-B (Fetub)

1-CSB-YP868762RA
  • EUR 586.00
  • EUR 299.00
  • EUR 2172.00
  • EUR 900.00
  • EUR 1442.00
  • EUR 382.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 41.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Fetuin-B(Fetub) expressed in Yeast

FETUB ELISA KIT|Human

EF006820 96 Tests
EUR 689

Mouse FETUB shRNA Plasmid

20-abx975181
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat FETUB shRNA Plasmid

20-abx986884
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human FETUB shRNA Plasmid

20-abx958915
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Recombinant Fetuin B (FETUB)

4-RPB860Hu01
  • EUR 451.23
  • EUR 224.00
  • EUR 1417.12
  • EUR 539.04
  • EUR 978.08
  • EUR 365.00
  • EUR 3392.80
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9UGM5
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 43.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Fetuin B expressed in: E.coli

Recombinant Fetuin B (FETUB)

4-RPB860Mu01
  • EUR 521.12
  • EUR 242.00
  • EUR 1679.20
  • EUR 626.40
  • EUR 1152.80
  • EUR 412.00
  • EUR 4048.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9QXC1
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 14.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Fetuin B expressed in: E.coli

Recombinant Fetuin B (FETUB)

4-RPB860Ra01
  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9QX79
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 13.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Fetuin B expressed in: E.coli

Recombinant Fetuin B (FETUB)

4-RPB860Ra02
  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9QX79
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 14.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Fetuin B expressed in: E.coli

FETUB Recombinant Protein (Human)

RP012064 100 ug Ask for price

FETUB Recombinant Protein (Rat)

RP201212 100 ug Ask for price

FETUB Recombinant Protein (Mouse)

RP134342 100 ug Ask for price

FETUB Recombinant Protein (Mouse)

RP134345 100 ug Ask for price

FETUB Recombinant Protein (Mouse)

RP134348 100 ug Ask for price

Human Fetuin B (FETUB) Protein

20-abx066554
  • EUR 634.00
  • EUR 272.00
  • EUR 1915.00
  • EUR 746.00
  • EUR 453.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

FETUB Rabbit Polyclonal Antibody

Recent Posts

Categories

January 2022
M T W T F S S
 12
3456789
10111213141516
17181920212223
24252627282930
31  

Pages