Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG

fallback-image

TIMD4 Rabbit Polyclonal Antibody

TIMD4 Rabbit Polyclonal Antibody

Contact us: [email protected]

TIMD4 Polyclonal Antibody

ES11159-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TIMD4 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

TIMD4 Antibody

1-CSB-PA850304LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TIMD4. Recognizes TIMD4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200

Anti-TIMD4 antibody

STJ192317 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to TIMD4

Human T-Cell Immunoglobulin And Mucin Domain Containing Protein 4 (TIMD4) ELISA Kit

DLR-TIMD4-Hu-48T 48T
EUR 517
  • Should the Human T-Cell Immunoglobulin And Mucin Domain Containing Protein 4 (TIMD4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human T-Cell Immunoglobulin And Mucin Domain Containing Protein 4 (TIMD4) in samples from tissue homogenates, cell lysates or other biological fluids.

Human T-Cell Immunoglobulin And Mucin Domain Containing Protein 4 (TIMD4) ELISA Kit

DLR-TIMD4-Hu-96T 96T
EUR 673
  • Should the Human T-Cell Immunoglobulin And Mucin Domain Containing Protein 4 (TIMD4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human T-Cell Immunoglobulin And Mucin Domain Containing Protein 4 (TIMD4) in samples from tissue homogenates, cell lysates or other biological fluids.

Human T-Cell Immunoglobulin And Mucin Domain Containing Protein 4 (TIMD4) ELISA Kit

RDR-TIMD4-Hu-48Tests 48 Tests
EUR 544

Human T-Cell Immunoglobulin And Mucin Domain Containing Protein 4 (TIMD4) ELISA Kit

RDR-TIMD4-Hu-96Tests 96 Tests
EUR 756

Human T-Cell Immunoglobulin And Mucin Domain Containing Protein 4 (TIMD4) ELISA Kit

RD-TIMD4-Hu-48Tests 48 Tests
EUR 521

Human T-Cell Immunoglobulin And Mucin Domain Containing Protein 4 (TIMD4) ELISA Kit

RD-TIMD4-Hu-96Tests 96 Tests
EUR 723

TIMD4 siRNA

20-abx936786
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TIMD4 siRNA

20-abx936787
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Polyclonal TIMD4 / TIM4 / TIM-4 Antibody (Internal)

APR02384G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TIMD4 / TIM4 / TIM-4 (Internal). This antibody is tested and proven to work in the following applications:

TIMD4 Antibody, HRP conjugated

1-CSB-PA850304LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TIMD4. Recognizes TIMD4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TIMD4 Antibody, FITC conjugated

1-CSB-PA850304LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TIMD4. Recognizes TIMD4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TIMD4 Antibody, Biotin conjugated

1-CSB-PA850304LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TIMD4. Recognizes TIMD4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Polyclonal TIMD4 / TIM4 / TIM-4 Antibody (C-Terminus)

APR02278G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TIMD4 / TIM4 / TIM-4 (C-Terminus). This antibody is tested and proven to work in the following applications:

TIMD4 cloning plasmid

CSB-CL850304HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1137
  • Sequence: atgtccaaagaacctctcattctctggctgatgattgagttttggtggctttacctgacaccagtcacttcagagactgttgtgacggaggttttgggtcaccgggtgactttgccctgtctgtactcatcctggtctcacaacagcaacagcatgtgctgggggaaagaccagt
  • Show more
Description: A cloning plasmid for the TIMD4 gene.

Mouse Timd4 ELISA KIT

ELI-29221m 96 Tests
EUR 865

Human TIMD4 ELISA KIT

ELI-29375h 96 Tests
EUR 824

Human TIMD4 shRNA Plasmid

20-abx964091
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse TIMD4 shRNA Plasmid

20-abx983161
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pCMV-SPORT6-TIMD4-T719C

PVT12945 2 ug
EUR 391

pET28a-Timd4-m-EGFP

PVT18015 2 ug
EUR 258

TIMD4 Recombinant Protein (Human)

RP031561 100 ug Ask for price

TIMD4 Recombinant Protein (Mouse)

RP178748 100 ug Ask for price

TIMD4 ORF Vector (Human) (pORF)

ORF010521 1.0 ug DNA
EUR 95

Timd4 ORF Vector (Mouse) (pORF)

ORF059584 1.0 ug DNA
EUR 506

TIMD4 ELISA Kit (Human) (OKAN06170)

OKAN06170 96 Wells
EUR 792
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.054 ng/mL

TIMD4 ELISA Kit (Human) (OKCD09113)

OKCD09113 96 Wells
EUR 975
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.054ng/mL

TIMD4 ELISA Kit (Human) (OKDD00559)

OKDD00559 96 Wells
EUR 975
Description: Description of target: Phosphatidylserine receptor that enhances the engulfment of apoptotic cells. Involved in regulating T-cell proliferation and lymphotoxin signaling. Ligand for HAVCR1/TIMD1.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.062 ng/mL

Timd4 sgRNA CRISPR Lentivector set (Mouse)

K3708501 3 x 1.0 ug
EUR 339

TIMD4 sgRNA CRISPR Lentivector set (Human)

K2374401 3 x 1.0 ug
EUR 339

Timd4 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3708502 1.0 ug DNA
EUR 154

Timd4 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3708503 1.0 ug DNA
EUR 154

Timd4 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3708504 1.0 ug DNA
EUR 154

TIMD4 sgRNA CRISPR Lentivector (Human) (Target 1)

K2374402 1.0 ug DNA
EUR 154

TIMD4 sgRNA CRISPR Lentivector (Human) (Target 2)

K2374403 1.0 ug DNA
EUR 154

TIMD4 sgRNA CRISPR Lentivector (Human) (Target 3)

K2374404 1.0 ug DNA
EUR 154

TIMD4 Protein Vector (Human) (pPB-C-His)

PV042081 500 ng
EUR 329

TIMD4 Protein Vector (Human) (pPB-N-His)

PV042082 500 ng
EUR 329

TIMD4 Protein Vector (Human) (pPM-C-HA)

PV042083 500 ng
EUR 329

TIMD4 Protein Vector (Human) (pPM-C-His)

PV042084 500 ng
EUR 329

TIMD4 Protein Vector (Mouse) (pPB-C-His)

PV238334 500 ng
EUR 603

TIMD4 Protein Vector (Mouse) (pPB-N-His)

PV238335 500 ng
EUR 603

TIMD4 Protein Vector (Mouse) (pPM-C-HA)

PV238336 500 ng
EUR 603

TIMD4 Protein Vector (Mouse) (pPM-C-His)

PV238337 500 ng
EUR 603

Timd4 3'UTR Luciferase Stable Cell Line

TU120495 1.0 ml Ask for price

Timd4 3'UTR GFP Stable Cell Line

TU170495 1.0 ml Ask for price

TIMD4 3'UTR GFP Stable Cell Line

TU075586 1.0 ml
EUR 1394

TIMD4 3'UTR Luciferase Stable Cell Line

TU025586 1.0 ml
EUR 1394

T-Cell Immunoglobulin And Mucin Domain Containing Protein 4 (TIMD4) Antibody

20-abx178542
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

T-Cell Immunoglobulin And Mucin Domain Containing Protein 4 (TIMD4) Antibody

20-abx174727
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

T-Cell immunoglobulin and mucin domain-Containing protein 4 (TIMD4) Antibody

abx031021-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

T-Cell immunoglobulin and mucin domain-Containing protein 4 (TIMD4) Antibody

abx031021-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

T-Cell immunoglobulin and mucin domain-Containing protein 4 (TIMD4) Antibody

20-abx318087
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

TIMD4 Rabbit Polyclonal Antibody

Recent Posts

Categories

January 2022
M T W T F S S
 12
3456789
10111213141516
17181920212223
24252627282930
31  

Pages