Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG


GPC2 Rabbit Polyclonal Antibody

GPC2 Rabbit Polyclonal Antibody

Contact us: [email protected]

GPC2 Polyclonal Antibody

ES10943-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against GPC2 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human Glypican 2 (GPC2) ELISA Kit

DLR-GPC2-Hu-48T 48T
EUR 498
  • Should the Human Glypican 2 (GPC2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Glypican 2 (GPC2) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Glypican 2 (GPC2) ELISA Kit

DLR-GPC2-Hu-96T 96T
EUR 647
  • Should the Human Glypican 2 (GPC2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Glypican 2 (GPC2) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Glypican 2 (GPC2) ELISA Kit

RDR-GPC2-Hu-48Tests 48 Tests
EUR 522

Human Glypican 2 (GPC2) ELISA Kit

RDR-GPC2-Hu-96Tests 96 Tests
EUR 724

Human Glypican 2 (GPC2) ELISA Kit

RD-GPC2-Hu-48Tests 48 Tests
EUR 500

Human Glypican 2 (GPC2) ELISA Kit

RD-GPC2-Hu-96Tests 96 Tests
EUR 692

GPC2 Antibody

47512-100ul 100ul
EUR 252

Rabbit GPC2 ELISA Kit

ERTG0234 96Tests
EUR 521

Polyclonal GPC2 Antibody (N-term)

APR16461G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPC2 (N-term). This antibody is tested and proven to work in the following applications:

Polyclonal GPC2 Antibody - C-terminal region

APR16462G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPC2 - C-terminal region. This antibody is tested and proven to work in the following applications:

GPC2 Conjugated Antibody

C47512 100ul
EUR 397

Anti-GPC2 Antibody

STJ193197 200 µl
EUR 197

Anti-GPC2 antibody

STJ192101 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to GPC2

Gpc2/ Rat Gpc2 ELISA Kit

ELI-04913r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Rabbit Glypican 2 (GPC2) ELISA Kit

abx363696-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Glypican 2 (GPC2) Antibody

  • EUR 1149.00
  • EUR 565.00
  • 1 mg
  • 200 ug
  • Please enquire.

Glypican 2 (GPC2) Antibody

  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.

Glypican 2 (GPC2) Antibody

abx028841-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Glypican 2 (GPC2) Antibody

abx028841-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

GPC2 cloning plasmid

CSB-CL818680HU-10ug 10ug
EUR 597
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1740
  • Sequence: atgtccgcgctgcgacctctcctgcttctgctgctgcctctgtgtcccggtcctggtcccggacccgggagcgaggcaaaggtcacccggagttgtgcagagacccggcaggtgctgggggcccggggatatagcttaaacctaatccctcccgccctgatctcaggtgagcacc
  • Show more
Description: A cloning plasmid for the GPC2 gene.

Human GPC2 ELISA Kit

EHG0234 96Tests
EUR 521

Human GPC2 ELISA Kit

ELA-E1493h 96 Tests
EUR 824


EGTG0234 96Tests
EUR 521

Bovine GPC2 ELISA Kit

EBG0234 96Tests
EUR 521

Canine GPC2 ELISA Kit

ECG0234 96Tests
EUR 521

Chicken GPC2 ELISA Kit

ECKG0234 96Tests
EUR 521

Anserini GPC2 ELISA Kit

EAG0234 96Tests
EUR 521


EF005822 96 Tests
EUR 689

Rat GPC2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse GPC2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GPC2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse GPC2 ELISA Kit

EMG0234 96Tests
EUR 521

GPC2 Rabbit Polyclonal Antibody

Recent Posts


January 2022
