Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG

fallback-image

REEP1 Rabbit Polyclonal Antibody

REEP1 Rabbit Polyclonal Antibody

Contact us: [email protected]

REEP1 Polyclonal Antibody
31353-50ul 50ul
EUR 187
REEP1 Polyclonal Antibody
ABP60123-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human REEP1 protein at amino acid sequence of 61-110
  • Applications tips:
Description: A polyclonal antibody for detection of REEP1 from Human, Mouse. This REEP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human REEP1 protein at amino acid sequence of 61-110
REEP1 Polyclonal Antibody
ABP60123-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human REEP1 protein at amino acid sequence of 61-110
  • Applications tips:
Description: A polyclonal antibody for detection of REEP1 from Human, Mouse. This REEP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human REEP1 protein at amino acid sequence of 61-110
REEP1 Polyclonal Antibody
ABP60123-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human REEP1 protein at amino acid sequence of 61-110
  • Applications tips:
Description: A polyclonal antibody for detection of REEP1 from Human, Mouse. This REEP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human REEP1 protein at amino acid sequence of 61-110
REEP1 Polyclonal Antibody
ES11440-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against REEP1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
REEP1 Polyclonal Antibody
ES11440-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against REEP1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
REEP1 Rabbit pAb
A7832-100ul 100 ul
EUR 308
REEP1 Rabbit pAb
A7832-200ul 200 ul
EUR 459
REEP1 Rabbit pAb
A7832-20ul 20 ul
EUR 183
REEP1 Rabbit pAb
A7832-50ul 50 ul
EUR 223
REEP1 Polyclonal Conjugated Antibody
C31353 100ul
EUR 397
REEP1 antibody
70R-19848 50 ul
EUR 435
Description: Rabbit polyclonal REEP1 antibody
REEP1 Antibody
1-CSB-PA862045DSR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against REEP1. Recognizes REEP1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200
REEP1 Antibody
1-CSB-PA862045DSR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against REEP1. Recognizes REEP1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200
REEP1 Antibody
DF12719 200ul
EUR 304
Description: REEP1 Antibody detects endogenous levels of REEP1.
REEP1 antibody
70R-7241 50 ug
EUR 467
Description: Rabbit polyclonal REEP1 antibody raised against the middle region of REEP1
REEP1 antibody
70R-7467 50 ug
EUR 467
Description: Rabbit polyclonal REEP1 antibody raised against the C terminal of REEP1
REEP1 Antibody
1-CSB-PA019540GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against REEP1. Recognizes REEP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
anti- REEP1 antibody
FNab07229 100µg
EUR 548.75
  • Immunogen: receptor accessory protein 1
  • Uniprot ID: Q9H902
  • Gene ID: 65055
  • Research Area: Metabolism
Description: Antibody raised against REEP1
Anti-REEP1 antibody
PAab07229 100 ug
EUR 386
Anti-REEP1 antibody
STJ110142 100 µl
EUR 277
Description: This gene encodes a mitochondrial protein that functions to enhance the cell surface expression of odorant receptors. Mutations in this gene cause spastic paraplegia autosomal dominant type 31, a neurodegenerative disorder. Alternative splicing results in multiple transcript variants.
Anti-REEP1 antibody
STJ192598 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to REEP1
REEP1 siRNA
20-abx931216
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
REEP1 siRNA
20-abx931217
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
Monoclonal antibody for REEP1
SMC-480D 0.1mg
EUR 353
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is not conjugated.
Monoclonal antibody for REEP1
SMC-480D-A390 0.1mg
EUR 400
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with ATTO 390.
Monoclonal antibody for REEP1
SMC-480D-A488 0.1mg
EUR 399
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with ATTO 488.
Monoclonal antibody for REEP1
SMC-480D-A565 0.1mg
EUR 399
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with ATTO 565.
Monoclonal antibody for REEP1
SMC-480D-A594 0.1mg
EUR 399
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with ATTO 594.
Monoclonal antibody for REEP1
SMC-480D-A633 0.1mg
EUR 399
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with ATTO 633.
Monoclonal antibody for REEP1
SMC-480D-A655 0.1mg
EUR 399
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with ATTO 655.
Monoclonal antibody for REEP1
SMC-480D-A680 0.1mg
EUR 399
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with ATTO 680.
Monoclonal antibody for REEP1
SMC-480D-A700 0.1mg
EUR 399
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with ATTO 700.
Monoclonal antibody for REEP1
SMC-480D-ALP 0.1mg
EUR 393
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with Alkaline Phosphatase.
Monoclonal antibody for REEP1
SMC-480D-APC 0.1mg
EUR 398
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with APC.
Monoclonal antibody for REEP1
SMC-480D-APCCY7 0.1mg
EUR 470
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with APC/Cy7.
Monoclonal antibody for REEP1
SMC-480D-BI 0.1mg
EUR 395
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with Biotin.
Monoclonal antibody for REEP1
SMC-480D-DY350 0.1mg
EUR 413
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with Dylight 350.
Monoclonal antibody for REEP1
SMC-480D-DY405 0.1mg
EUR 402
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with Dylight 405.
Monoclonal antibody for REEP1
SMC-480D-DY488 0.1mg
EUR 392
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with Dylight 488.
Monoclonal antibody for REEP1
SMC-480D-DY594 0.1mg
EUR 394
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with Dylight 594.
Monoclonal antibody for REEP1
SMC-480D-DY633 0.1mg
EUR 389
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with Dylight 633.
Monoclonal antibody for REEP1
SMC-480D-FITC 0.1mg
EUR 391
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with FITC.
Monoclonal antibody for REEP1
SMC-480D-HRP 0.1mg
EUR 387
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with HRP.
Monoclonal antibody for REEP1
SMC-480D-P594 0.1mg
EUR 406
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with PE/ATTO 594.
Monoclonal antibody for REEP1
SMC-480D-PCP 0.1mg
EUR 398
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with PerCP.
Monoclonal antibody for REEP1
SMC-480D-RPE 0.1mg
EUR 396
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with RPE.
Monoclonal antibody for REEP1
SMC-480D-STR 0.1mg
EUR 397
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is conjugated with Streptavidin.
Monoclonal antibody for REEP1
SMC-480S 0.012mg
EUR 65
  • REEP1 (receptor expression-enhancing protein 1), is a 201 amino acid multi-pass mitochondrion membrane protein that belongs to the DP1 family. REEP1 interacts with odorant receptor proteins and may enhance the cell surface expression of odorant recep
  • Show more
Description: A monoclonal antibody from clone S345-51 against Human REEP1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-201 of mouse REEP1. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1 is not conjugated.
REEP1 Blocking Peptide
33R-2704 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of REEP1 antibody, catalog no. 70R-7467
REEP1 Blocking Peptide
33R-1288 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ADCYAP1R1 antibody, catalog no. 70R-9939
REEP1 Blocking Peptide
DF12719-BP 1mg
EUR 195
REEP1 cloning plasmid
CSB-CL862045HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 606
  • Sequence: atggtgtcatggatcatctccaggctggtggtgcttatatttggcaccctttaccctgcgtattattcctacaaggctgtgaaatcaaaggacattaaggaatatgtcaaatggatgatgtactggattatatttgcacttttcaccacagcagagacattcacagacatcttcct
  • Show more
Description: A cloning plasmid for the REEP1 gene.
Monoclonal antibody for REEP1/2
SMC-482D 0.1mg
EUR 353
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is not conjugated.
Monoclonal antibody for REEP1/2
SMC-482D-A390 0.1mg
EUR 400
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with ATTO 390.
Monoclonal antibody for REEP1/2
SMC-482D-A488 0.1mg
EUR 399
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with ATTO 488.
Monoclonal antibody for REEP1/2
SMC-482D-A565 0.1mg
EUR 399
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with ATTO 565.
Monoclonal antibody for REEP1/2
SMC-482D-A594 0.1mg
EUR 399
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with ATTO 594.
Monoclonal antibody for REEP1/2
SMC-482D-A633 0.1mg
EUR 399
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with ATTO 633.
Monoclonal antibody for REEP1/2
SMC-482D-A655 0.1mg
EUR 399
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with ATTO 655.
Monoclonal antibody for REEP1/2
SMC-482D-A680 0.1mg
EUR 399
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with ATTO 680.
Monoclonal antibody for REEP1/2
SMC-482D-A700 0.1mg
EUR 399
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with ATTO 700.
Monoclonal antibody for REEP1/2
SMC-482D-ALP 0.1mg
EUR 393
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with Alkaline Phosphatase.
Monoclonal antibody for REEP1/2
SMC-482D-APC 0.1mg
EUR 398
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with APC.
Monoclonal antibody for REEP1/2
SMC-482D-APCCY7 0.1mg
EUR 470
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with APC/Cy7.
Monoclonal antibody for REEP1/2
SMC-482D-BI 0.1mg
EUR 395
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with Biotin.
Monoclonal antibody for REEP1/2
SMC-482D-DY350 0.1mg
EUR 413
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with Dylight 350.
Monoclonal antibody for REEP1/2
SMC-482D-DY405 0.1mg
EUR 402
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with Dylight 405.
Monoclonal antibody for REEP1/2
SMC-482D-DY488 0.1mg
EUR 392
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with Dylight 488.
Monoclonal antibody for REEP1/2
SMC-482D-DY594 0.1mg
EUR 394
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with Dylight 594.
Monoclonal antibody for REEP1/2
SMC-482D-DY633 0.1mg
EUR 389
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with Dylight 633.
Monoclonal antibody for REEP1/2
SMC-482D-FITC 0.1mg
EUR 391
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with FITC.
Monoclonal antibody for REEP1/2
SMC-482D-HRP 0.1mg
EUR 387
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with HRP.
Monoclonal antibody for REEP1/2
SMC-482D-P594 0.1mg
EUR 406
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with PE/ATTO 594.
Monoclonal antibody for REEP1/2
SMC-482D-PCP 0.1mg
EUR 398
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with PerCP.
Monoclonal antibody for REEP1/2
SMC-482D-RPE 0.1mg
EUR 396
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with RPE.
Monoclonal antibody for REEP1/2
SMC-482D-STR 0.1mg
EUR 397
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is conjugated with Streptavidin.
Monoclonal antibody for REEP1/2
SMC-482S 0.012mg
EUR 65
Description: A monoclonal antibody from clone S326D-29 against Human REEP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 111-254 (Cytoplasmic C-terminus) of mouse REEP2.. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This MAb for REEP1/2 is not conjugated.
Receptor Accessory Protein 1 (REEP1) Antibody
20-abx007076
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Receptor Accessory Protein 1 (REEP1) Antibody
20-abx115085
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Receptor Accessory Protein 1 (REEP1) Antibody
20-abx142193
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
Receptor Accessory Protein 1 (REEP1) Antibody
abx237229-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Receptor Accessory Protein 1 (REEP1) Antibody
20-abx322525
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Receptor Accessory Protein 1 (REEP1) Antibody
20-abx322526
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Receptor Accessory Protein 1 (REEP1) Antibody
abx445089-100ug 100 ug
EUR 523
  • Shipped within 5-12 working days.
REEP1 ELISA KIT|Human
EF002407 96 Tests
EUR 689
Mouse REEP1 shRNA Plasmid
20-abx974224
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human REEP1 shRNA Plasmid
20-abx962166
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
REEP1 Recombinant Protein (Human)
RP026134 100 ug Ask for price
REEP1 Recombinant Protein (Mouse)
RP167513 100 ug Ask for price
REEP1 Recombinant Protein (Rat)
RP224024 100 ug Ask for price
Receptor Accessory Protein 1 (REEP1) Antibody (ALP)
abx442486-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
Receptor Accessory Protein 1 (REEP1) Antibody (APC)
abx442767-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
Receptor Accessory Protein 1 (REEP1) Antibody (Biotin)
abx443047-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
Receptor Accessory Protein 1 (REEP1) Antibody (FITC)
abx443327-100ug 100 ug
EUR 565
  • Shipped within 5-12 working days.
Receptor Accessory Protein 1 (REEP1) Antibody (HRP)
abx443608-100ug 100 ug
EUR 565
  • Shipped within 5-12 working days.
Receptor Accessory Protein 1 (REEP1) Antibody (PerCP)
abx444170-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
Receptor Accessory Protein 1 (REEP1) Antibody (RPE)
abx444451-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
Receptor Accessory Protein 1 (REEP1) Antibody (Streptavidin)
abx444732-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

REEP1 Rabbit Polyclonal Antibody

Recent Posts

Categories

January 2022
M T W T F S S
 12
3456789
10111213141516
17181920212223
24252627282930
31  

Pages