PPM1B Rabbit Polyclonal Antibody

Contact us: [email protected]

PPM1B Polyclonal Antibody
ES11231-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against PPM1B from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

PPM1B antibody
70R-19459	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal PPM1B antibody

PPM1B antibody
70R-2682	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal PPM1B antibody

PPM1B Antibody
47357-100ul	SAB	100ul	EUR 252

PPM1B antibody
10R-5376	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal PPM1B antibody

PPM1B antibody
10R-5377	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal PPM1B antibody

PPM1B antibody
10R-5378	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal PPM1B antibody

PPM1B antibody
10R-5379	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal PPM1B antibody

PPM1B antibody
10R-5380	Fitzgerald	100 ul	EUR 726
Description: Mouse monoclonal PPM1B antibody

PPM1B antibody
10R-5381	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal PPM1B antibody

PPM1B antibody
10R-1090	Fitzgerald	100 ul	EUR 316
Description: Mouse monoclonal PPM1B antibody

PPM1B Antibody
1-CSB-PA018490GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PPM1B. Recognizes PPM1B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

PPM1B Conjugated Antibody
C47357	SAB	100ul	EUR 397

anti- PPM1B antibody
FNab06685	FN Test	100µg	EUR 505.25
Immunogen: protein phosphatase 1B(formerly 2C), magnesium-dependent, beta isoform Uniprot ID: O75688 Gene ID: 5495 Research Area: Signal Transduction, Metabolism
Description: Antibody raised against PPM1B

Anti-PPM1B antibody
PAab06685	Lifescience Market	100 ug	EUR 355

Anti-PPM1B antibody
STJ192389	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to PPM1B

Ppm1b/ Rat Ppm1b ELISA Kit
ELI-43109r	Lifescience Market	96 Tests	EUR 886

PPM1B siRNA
20-abx904165	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PPM1B siRNA
20-abx929427	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PPM1B siRNA
20-abx929428	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-PPM1B
YF-PA13921	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to PPM1B

anti-PPM1B
YF-PA13922	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to PPM1B

anti-PPM1B
YF-PA13923	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to PPM1B

PPM1B Blocking Peptide
33R-2480	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PPM1B antibody, catalog no. 70R-2682

PPM1B cloning plasmid
CSB-CL018490HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 579 Sequence: atgagtattgtactagtttgcttttcaaatgctcccaaggtctcagatgaagcggtgaaaaaagattcagagttggataagcacttggaatcacgggttgaagagattatggagaagtctggcgaggaaggaatgcctgatcttgcccatgtcatgcgcatcttgtctgcagaaaa Show more
Description: A cloning plasmid for the PPM1B gene.

PPM1B ELISA KIT|Human
EF001983	Lifescience Market	96 Tests	EUR 689

Mouse PPM1B shRNA Plasmid
20-abx972166	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat PPM1B shRNA Plasmid
20-abx984589	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human PPM1B shRNA Plasmid
20-abx953681	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

PPM1B Recombinant Protein (Human)
RP024307	ABM	100 ug	Ask for price

PPM1B Recombinant Protein (Mouse)
RP163787	ABM	100 ug	Ask for price

PPM1B Recombinant Protein (Mouse)
RP163790	ABM	100 ug	Ask for price

PPM1B Recombinant Protein (Mouse)
RP163793	ABM	100 ug	Ask for price

PPM1B Recombinant Protein (Mouse)
RP163796	ABM	100 ug	Ask for price

PPM1B Recombinant Protein (Rat)
RP221648	ABM	100 ug	Ask for price

Anti-PPM1B (1A3-2A4)
YF-MA14833	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to PPM1B

Human Protein phosphatase 1B (PPM1B)
1-CSB-EP018490HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 36.6 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Protein phosphatase 1B(PPM1B) expressed in E.coli

Ppm1b ORF Vector (Rat) (pORF)
ORF073884	ABM	1.0 ug DNA	EUR 506

PPM1B ORF Vector (Human) (pORF)
ORF008103	ABM	1.0 ug DNA	EUR 95

Ppm1b ORF Vector (Mouse) (pORF)
ORF054597	ABM	1.0 ug DNA	EUR 506

Ppm1b ORF Vector (Mouse) (pORF)
ORF054598	ABM	1.0 ug DNA	EUR 506

Ppm1b ORF Vector (Mouse) (pORF)
ORF054599	ABM	1.0 ug DNA	EUR 506

Ppm1b ORF Vector (Mouse) (pORF)
ORF054600	ABM	1.0 ug DNA	EUR 506

PPM1B ELISA Kit (Human) (OKCD04220)
OKCD04220	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: The protein encoded by this gene is a member of the PP2C family of Ser/Thr protein phosphatases. PP2C family members are known to be negative regulators of cell stress response pathways. This phosphatase has been shown to dephosphorylate cyclin-dependent kinases (CDKs), and thus may be involved in cell cycle control. Overexpression of this phosphatase is reported to cause cell-growth arrest or cell death. Alternative splicing results in multiple transcript variants encoding different isoforms. Additional transcript variants have been described, but currently do not represent full-length sequences.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.055 ng/mL

Protein Phosphatase, Mg2+/Mn2+ Dependent 1B (PPM1B) Antibody
20-abx114840	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Protein Phosphatase, Mg2+/Mn2+ Dependent 1B (PPM1B) Antibody
abx236685-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Monoclonal PPM1B Antibody (monoclonal) (M01), Clone: 1A3-2A4
AMM03931G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human PPM1B (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1A3-2A4. This antibody is applicable in WB and IF, IP, E

Ppm1b sgRNA CRISPR Lentivector set (Rat)
K6655601	ABM	3 x 1.0 ug	EUR 339

Ppm1b sgRNA CRISPR Lentivector set (Mouse)
K4554101	ABM	3 x 1.0 ug	EUR 339

PPM1B sgRNA CRISPR Lentivector set (Human)
K1700401	ABM	3 x 1.0 ug	EUR 339

Mouse Protein phosphatase 1B, Ppm1b ELISA KIT
ELI-15413m	Lifescience Market	96 Tests	EUR 865

Bovine Protein phosphatase 1B, PPM1B ELISA KIT
ELI-21763b	Lifescience Market	96 Tests	EUR 928

Human Protein phosphatase 1B, PPM1B ELISA KIT
ELI-22337h	Lifescience Market	96 Tests	EUR 824

Ppm1b sgRNA CRISPR Lentivector (Rat) (Target 1)
K6655602	ABM	1.0 ug DNA	EUR 154

Ppm1b sgRNA CRISPR Lentivector (Rat) (Target 2)
K6655603	ABM	1.0 ug DNA	EUR 154

Ppm1b sgRNA CRISPR Lentivector (Rat) (Target 3)
K6655604	ABM	1.0 ug DNA	EUR 154

Ppm1b sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4554102	ABM	1.0 ug DNA	EUR 154

Ppm1b sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4554103	ABM	1.0 ug DNA	EUR 154

Ppm1b sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4554104	ABM	1.0 ug DNA	EUR 154

PPM1B sgRNA CRISPR Lentivector (Human) (Target 1)
K1700402	ABM	1.0 ug DNA	EUR 154

PPM1B sgRNA CRISPR Lentivector (Human) (Target 2)
K1700403	ABM	1.0 ug DNA	EUR 154

PPM1B sgRNA CRISPR Lentivector (Human) (Target 3)
K1700404	ABM	1.0 ug DNA	EUR 154

PPM1B Protein Vector (Rat) (pPB-C-His)
PV295534	ABM	500 ng	EUR 603

PPM1B Protein Vector (Rat) (pPB-N-His)
PV295535	ABM	500 ng	EUR 603

PPM1B Protein Vector (Rat) (pPM-C-HA)
PV295536	ABM	500 ng	EUR 603

PPM1B Protein Vector (Rat) (pPM-C-His)
PV295537	ABM	500 ng	EUR 603

PPM1B Protein Vector (Human) (pPB-C-His)
PV032409	ABM	500 ng	EUR 329

PPM1B Protein Vector (Human) (pPB-N-His)
PV032410	ABM	500 ng	EUR 329

PPM1B Protein Vector (Human) (pPM-C-HA)
PV032411	ABM	500 ng	EUR 329

PPM1B Protein Vector (Human) (pPM-C-His)
PV032412	ABM	500 ng	EUR 329

PPM1B Protein Vector (Mouse) (pPB-C-His)
PV218386	ABM	500 ng	EUR 603

PPM1B Protein Vector (Mouse) (pPB-N-His)
PV218387	ABM	500 ng	EUR 603

PPM1B Protein Vector (Mouse) (pPM-C-HA)
PV218388	ABM	500 ng	EUR 603

PPM1B Protein Vector (Mouse) (pPM-C-His)
PV218389	ABM	500 ng	EUR 603

PPM1B Protein Vector (Mouse) (pPB-C-His)
PV218390	ABM	500 ng	EUR 603

PPM1B Protein Vector (Mouse) (pPB-N-His)
PV218391	ABM	500 ng	EUR 603

PPM1B Protein Vector (Mouse) (pPM-C-HA)
PV218392	ABM	500 ng	EUR 603

PPM1B Protein Vector (Mouse) (pPM-C-His)
PV218393	ABM	500 ng	EUR 603

PPM1B Protein Vector (Mouse) (pPB-C-His)
PV218394	ABM	500 ng	EUR 603

PPM1B Protein Vector (Mouse) (pPB-N-His)
PV218395	ABM	500 ng	EUR 603

PPM1B Protein Vector (Mouse) (pPM-C-HA)
PV218396	ABM	500 ng	EUR 603

PPM1B Protein Vector (Mouse) (pPM-C-His)
PV218397	ABM	500 ng	EUR 603

PPM1B Protein Vector (Mouse) (pPB-C-His)
PV218398	ABM	500 ng	EUR 603

PPM1B Protein Vector (Mouse) (pPB-N-His)
PV218399	ABM	500 ng	EUR 603

PPM1B Protein Vector (Mouse) (pPM-C-HA)
PV218400	ABM	500 ng	EUR 603

PPM1B Protein Vector (Mouse) (pPM-C-His)
PV218401	ABM	500 ng	EUR 603

Ppm1b 3'UTR Luciferase Stable Cell Line
TU116787	ABM	1.0 ml	Ask for price

Ppm1b 3'UTR GFP Stable Cell Line
TU166787	ABM	1.0 ml	Ask for price

Ppm1b 3'UTR Luciferase Stable Cell Line
TU216633	ABM	1.0 ml	Ask for price

Ppm1b 3'UTR GFP Stable Cell Line
TU266633	ABM	1.0 ml	Ask for price

PPM1B 3'UTR GFP Stable Cell Line
TU068605	ABM	1.0 ml	EUR 1521

PPM1B 3'UTR Luciferase Stable Cell Line
TU018605	ABM	1.0 ml	EUR 1521

PPM1B Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV691027	ABM	1.0 ug DNA	EUR 682

PPM1B Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV691031	ABM	1.0 ug DNA	EUR 682

PPM1B Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV691032	ABM	1.0 ug DNA	EUR 682

ELISA kit for Bovine Protein phosphatase 1B (PPM1B)
KTE10196-48T	Abbkine	48T	EUR 354
PPM1B is a member of the PP2C family of Ser/Thr protein phosphatases. PP2C family members are known to be negative regulators of cell stress response pathways. This phosphatase has been shown to dephosphorylate cyclin-dependent kinases (CDKs), and th Show more
Description: Quantitative sandwich ELISA for measuring Bovine Protein phosphatase 1B (PPM1B) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

PPM1B Rabbit Polyclonal Antibody