IL23R Rabbit Polyclonal Antibody

Contact us: [email protected]

IL23R Polyclonal Antibody
ABP58924-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human IL23R protein Applications tips:
Description: A polyclonal antibody for detection of IL23R from Human, Mouse. This IL23R antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human IL23R protein

IL23R Polyclonal Antibody
ES11153-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against IL23R from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

IL23R Polyclonal Antibody
ES11153-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against IL23R from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human Interleukin 23 Receptor (IL23R) ELISA Kit
DLR-IL23R-Hu-48T	DL Develop	48T	EUR 463
Should the Human Interleukin 23 Receptor (IL23R) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Interleukin 23 Receptor (IL23R) in samples from tissue homogenates or other biological fluids.

Human Interleukin 23 Receptor (IL23R) ELISA Kit
DLR-IL23R-Hu-96T	DL Develop	96T	EUR 599
Should the Human Interleukin 23 Receptor (IL23R) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Interleukin 23 Receptor (IL23R) in samples from tissue homogenates or other biological fluids.

Rat Interleukin 23 Receptor (IL23R) ELISA Kit
DLR-IL23R-Ra-48T	DL Develop	48T	EUR 495
Should the Rat Interleukin 23 Receptor (IL23R) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Interleukin 23 Receptor (IL23R) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Interleukin 23 Receptor (IL23R) ELISA Kit
DLR-IL23R-Ra-96T	DL Develop	96T	EUR 644
Should the Rat Interleukin 23 Receptor (IL23R) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Interleukin 23 Receptor (IL23R) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Interleukin 23 Receptor (IL23R) ELISA Kit
RDR-IL23R-Hu-48Tests	Reddot Biotech	48 Tests	EUR 481

Human Interleukin 23 Receptor (IL23R) ELISA Kit
RDR-IL23R-Hu-96Tests	Reddot Biotech	96 Tests	EUR 665

Rat Interleukin 23 Receptor (IL23R) ELISA Kit
RDR-IL23R-Ra-48Tests	Reddot Biotech	48 Tests	EUR 519

Rat Interleukin 23 Receptor (IL23R) ELISA Kit
RDR-IL23R-Ra-96Tests	Reddot Biotech	96 Tests	EUR 720

Human Interleukin 23 Receptor (IL23R) ELISA Kit
RD-IL23R-Hu-48Tests	Reddot Biotech	48 Tests	EUR 460

Human Interleukin 23 Receptor (IL23R) ELISA Kit
RD-IL23R-Hu-96Tests	Reddot Biotech	96 Tests	EUR 636

Rat Interleukin 23 Receptor (IL23R) ELISA Kit
RD-IL23R-Ra-48Tests	Reddot Biotech	48 Tests	EUR 496

Rat Interleukin 23 Receptor (IL23R) ELISA Kit
RD-IL23R-Ra-96Tests	Reddot Biotech	96 Tests	EUR 688

IL23R Rabbit pAb
A1613-100ul	Abclonal	100 ul	EUR 308

IL23R Rabbit pAb
A1613-200ul	Abclonal	200 ul	EUR 459

IL23R Rabbit pAb
A1613-20ul	Abclonal	20 ul	EUR 183

IL23R Rabbit pAb
A1613-50ul	Abclonal	50 ul	EUR 223

IL23R Antibody
31023-100ul	SAB	100ul	EUR 252

IL23R Antibody
31023-50ul	SAB	50ul	EUR 187

IL23R Antibody
32341-100ul	SAB	100ul	EUR 252

IL23R Antibody
1-CSB-PA929770	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against IL23R. Recognizes IL23R from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:500-1:5000, IHC:1:10-1:50

IL23R Antibody
1-CSB-PA733162LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IL23R. Recognizes IL23R from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

IL23R Antibody
DF6501	Affbiotech	200ul	EUR 304
Description: IL23R Antibody detects endogenous levels of total IL23R.

IL23R Antibody
1-CSB-PA273292	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against IL23R. Recognizes IL23R from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:500-1:5000, WB:1:500-1:2000, IHC:1:5-1:20

IL23R Antibody
CSB-PA011639KA01HU-	Cusabio		EUR 335
Form: liquid Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against IL23R. Recognizes IL23R from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

IL23R Antibody
CSB-PA011639KA01HU-100ul	Cusabio	100ul	EUR 389
Form: liquid Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against IL23R. Recognizes IL23R from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

IL23R Antibody
ABD6501	Lifescience Market	100 ug	EUR 438

IL23R Conjugated Antibody
C32341	SAB	100ul	EUR 397

IL23R Conjugated Antibody
C31023	SAB	100ul	EUR 397

Anti-IL23R antibody
STJ24181	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a subunit of the receptor for IL23A/IL23. This protein pairs with the receptor molecule IL12RB1/IL12Rbeta1, and both are required for IL23A signaling. This protein associates constitutively with Janus kinase 2 (JAK2), and also binds to transcription activator STAT3 in a ligand-dependent manner.

Anti-IL23R antibody
STJ192311	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to IL23R

Interleukin 23 Receptor (IL23R) Polyclonal Antibody (Rat)
4-PAE765Ra01	Cloud-Clone	EUR 259.00 EUR 2708.00 EUR 670.00 EUR 328.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL23R (Ile25~Leu355) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 23 Receptor (IL23R)

IL23R siRNA
20-abx920488	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

IL23R siRNA
20-abx920489	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

IL23R Antibody, HRP conjugated
1-CSB-PA733162LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IL23R. Recognizes IL23R from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

IL23R Antibody, FITC conjugated
1-CSB-PA733162LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IL23R. Recognizes IL23R from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

IL23R Antibody, Biotin conjugated
1-CSB-PA733162LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IL23R. Recognizes IL23R from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Interleukin 23 Receptor (IL23R) Polyclonal Antibody (Rat), APC
4-PAE765Ra01-APC	Cloud-Clone	EUR 364.00 EUR 3545.00 EUR 980.00 EUR 467.00 EUR 227.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL23R (Ile25~Leu355) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 23 Receptor (IL23R). This antibody is labeled with APC.

Interleukin 23 Receptor (IL23R) Polyclonal Antibody (Rat), Biotinylated
4-PAE765Ra01-Biotin	Cloud-Clone	EUR 325.00 EUR 2658.00 EUR 777.00 EUR 400.00 EUR 225.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL23R (Ile25~Leu355) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 23 Receptor (IL23R). This antibody is labeled with Biotin.

Interleukin 23 Receptor (IL23R) Polyclonal Antibody (Rat), Cy3
4-PAE765Ra01-Cy3	Cloud-Clone	EUR 444.00 EUR 4685.00 EUR 1265.00 EUR 581.00 EUR 261.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL23R (Ile25~Leu355) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 23 Receptor (IL23R). This antibody is labeled with Cy3.

Interleukin 23 Receptor (IL23R) Polyclonal Antibody (Rat), FITC
4-PAE765Ra01-FITC	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL23R (Ile25~Leu355) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 23 Receptor (IL23R). This antibody is labeled with FITC.

Interleukin 23 Receptor (IL23R) Polyclonal Antibody (Rat), HRP
4-PAE765Ra01-HRP	Cloud-Clone	EUR 332.00 EUR 3089.00 EUR 866.00 EUR 421.00 EUR 213.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL23R (Ile25~Leu355) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 23 Receptor (IL23R). This antibody is labeled with HRP.

Interleukin 23 Receptor (IL23R) Polyclonal Antibody (Rat), PE
4-PAE765Ra01-PE	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL23R (Ile25~Leu355) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 23 Receptor (IL23R). This antibody is labeled with PE.

IL23R Blocking Peptide
DF6501-BP	Affbiotech	1mg	EUR 195

IL23R cloning plasmid
CSB-CL733162HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 684 Sequence: atgaaaaacagcaatgttgtgaaaatgctacaggaaaatagtgaacttatgaataataattccagtgagcaggtcctatatgttgatcccatgattacagagataaaagaaatcttcatcccagaacacaagcctacagactacaagaaggagaatacaggacccctggagacaag Show more
Description: A cloning plasmid for the IL23R gene.

Anti-IL23 Receptor/Il23r Antibody
A00607-1	BosterBio	100ug/vial	EUR 294

Interleukin 23 Receptor (IL23R) Antibody
20-abx177153	Abbexa	EUR 1205.00 EUR 578.00	1 mg 200 ug
Please enquire.

Interleukin 23 Receptor (IL23R) Antibody
20-abx211433	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Interleukin 23 Receptor (IL23R) Antibody
20-abx211458	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Interleukin 23 Receptor (IL23R) Antibody
abx117124-100ug	Abbexa	100 ug	EUR 467
Shipped within 5-10 working days.

Interleukin 23 Receptor (IL23R) Antibody
abx038078-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Interleukin 23 Receptor (IL23R) Antibody
20-abx130103	Abbexa	EUR 453.00 EUR 133.00 EUR 1302.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Interleukin 23 Receptor (IL23R) Antibody
20-abx173141	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Interleukin 23 Receptor (IL23R) Antibody
20-abx173142	Abbexa	EUR 913.00 EUR 467.00	1 mg 200 ug
Please enquire.

Interleukin 23 Receptor (IL23R) Antibody
abx029221-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Interleukin 23 Receptor (IL23R) Antibody
abx029221-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Interleukin 23 Receptor (IL23R) Antibody
20-abx318211	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Interleukin 23 Receptor (IL23R) Antibody
20-abx001357	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Interleukin 23 Receptor (IL23R) Polyclonal Antibody (Rat), APC-Cy7
4-PAE765Ra01-APC-Cy7	Cloud-Clone	EUR 608.00 EUR 6970.00 EUR 1840.00 EUR 814.00 EUR 335.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL23R (Ile25~Leu355) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 23 Receptor (IL23R). This antibody is labeled with APC-Cy7.

Interleukin 23 Receptor (IL23R) Antibody (HRP)
20-abx315055	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Interleukin 23 Receptor (IL23R) Antibody (FITC)
20-abx315056	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Interleukin 23 Receptor (IL23R) Antibody (Biotin)
20-abx315057	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

IL23R ELISA KIT|Human
EF005147	Lifescience Market	96 Tests	EUR 689

Human IL23R shRNA Plasmid
20-abx965609	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse IL23R shRNA Plasmid
20-abx980628	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Monoclonal IL23R Antibody (monoclonal) (M01), Clone: 3D7
APR16851G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human IL23R (monoclonal) (M01). The antibodies are raised in mouse and are from clone 3D7. This antibody is applicable in WB, E

IL23R ORF Vector (Human) (pORF)
ORF005340	ABM	1.0 ug DNA	EUR 95

Il23r ORF Vector (Mouse) (pORF)
ORF047869	ABM	1.0 ug DNA	EUR 506

IL23R ELISA Kit (Human) (OKBB01127)
OKBB01127	Aviva Systems Biology	96 Wells	EUR 544
Description: Description of target: Interleukin-23 subunit alpha is a protein that in humans is encoded by the IL23A gene. The protein encoded by this gene is a subunit of the receptor for IL23A/IL23. This protein pairs with the receptor molecule IL12RB1/IL12Rbeta1, and both are required for IL23A signaling. This protein associates constitutively with Janus kinase 2 (JAK2), and also binds to transcription activator STAT3 in a ligand-dependent manner.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

Il23r ELISA Kit (Mouse) (OKBB01128)
OKBB01128	Aviva Systems Biology	96 Wells	EUR 505
Description: Description of target: Interleukin-23 subunit alpha is a protein that in humans is encoded by the IL23A gene. The protein encoded by this gene is a subunit of the receptor for IL23A/IL23. This protein pairs with the receptor molecule IL12RB1/IL12Rbeta1, and both are required for IL23A signaling. This protein associates constitutively with Janus kinase 2 (JAK2), and also binds to transcription activator STAT3 in a ligand-dependent manner.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

IL23R ELISA Kit (Mouse) (OKCA01701)
OKCA01701	Aviva Systems Biology	96 Wells	EUR 846
Description: Description of target: Associates with IL12RB1 to form the interleukin-23 receptor. Binds IL23 and mediates T-cells, NK cells and possibly certain macrophage/myeloid cells stimulation probably through activation of the Jak-Stat signaling cascade. IL23 functions in innate and adaptive immunity and may participate in acute response to infection in peripheral tissues. IL23 may be responsible for autoimmune inflammatory diseases and be important for tumorigenesis.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 7.8 pg/mL

IL23R ELISA Kit (Human) (OKCD08697)
OKCD08697	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: The protein encoded by this gene is a subunit of the receptor for IL23A/IL23. This protein pairs with the receptor molecule IL12RB1/IL12Rbeta1, and both are required for IL23A signaling. This protein associates constitutively with Janus kinase 2 (JAK2), and also binds to transcription activator STAT3 in a ligand-dependent manner.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.059ng/mL

IL23R Rabbit Polyclonal Antibody