Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG

fallback-image

IL23R Rabbit Polyclonal Antibody

IL23R Rabbit Polyclonal Antibody

Contact us: [email protected]

IL23R Polyclonal Antibody

ABP58924-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human IL23R protein
  • Applications tips:
Description: A polyclonal antibody for detection of IL23R from Human, Mouse. This IL23R antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human IL23R protein

IL23R Polyclonal Antibody

ES11153-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IL23R from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

IL23R Polyclonal Antibody

ES11153-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IL23R from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human Interleukin 23 Receptor (IL23R) ELISA Kit

DLR-IL23R-Hu-48T 48T
EUR 463
  • Should the Human Interleukin 23 Receptor (IL23R) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Interleukin 23 Receptor (IL23R) in samples from tissue homogenates or other biological fluids.

Human Interleukin 23 Receptor (IL23R) ELISA Kit

DLR-IL23R-Hu-96T 96T
EUR 599
  • Should the Human Interleukin 23 Receptor (IL23R) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Interleukin 23 Receptor (IL23R) in samples from tissue homogenates or other biological fluids.

Rat Interleukin 23 Receptor (IL23R) ELISA Kit

DLR-IL23R-Ra-48T 48T
EUR 495
  • Should the Rat Interleukin 23 Receptor (IL23R) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Interleukin 23 Receptor (IL23R) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Interleukin 23 Receptor (IL23R) ELISA Kit

DLR-IL23R-Ra-96T 96T
EUR 644
  • Should the Rat Interleukin 23 Receptor (IL23R) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Interleukin 23 Receptor (IL23R) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Interleukin 23 Receptor (IL23R) ELISA Kit

RDR-IL23R-Hu-48Tests 48 Tests
EUR 481

Human Interleukin 23 Receptor (IL23R) ELISA Kit

RDR-IL23R-Hu-96Tests 96 Tests
EUR 665

Rat Interleukin 23 Receptor (IL23R) ELISA Kit

RDR-IL23R-Ra-48Tests 48 Tests
EUR 519

Rat Interleukin 23 Receptor (IL23R) ELISA Kit

RDR-IL23R-Ra-96Tests 96 Tests
EUR 720

Human Interleukin 23 Receptor (IL23R) ELISA Kit

RD-IL23R-Hu-48Tests 48 Tests
EUR 460

Human Interleukin 23 Receptor (IL23R) ELISA Kit

RD-IL23R-Hu-96Tests 96 Tests
EUR 636

Rat Interleukin 23 Receptor (IL23R) ELISA Kit

RD-IL23R-Ra-48Tests 48 Tests
EUR 496

Rat Interleukin 23 Receptor (IL23R) ELISA Kit

RD-IL23R-Ra-96Tests 96 Tests
EUR 688

IL23R Rabbit pAb

A1613-100ul 100 ul
EUR 308

IL23R Rabbit pAb

A1613-200ul 200 ul
EUR 459

IL23R Rabbit pAb

A1613-20ul 20 ul
EUR 183

IL23R Rabbit pAb

A1613-50ul 50 ul
EUR 223

IL23R Antibody

31023-100ul 100ul
EUR 252

IL23R Antibody

31023-50ul 50ul
EUR 187

IL23R Antibody

32341-100ul 100ul
EUR 252

IL23R Antibody

1-CSB-PA929770
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against IL23R. Recognizes IL23R from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:500-1:5000, IHC:1:10-1:50

IL23R Antibody

1-CSB-PA733162LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IL23R. Recognizes IL23R from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

IL23R Antibody

DF6501 200ul
EUR 304
Description: IL23R Antibody detects endogenous levels of total IL23R.

IL23R Antibody

1-CSB-PA273292
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against IL23R. Recognizes IL23R from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:500-1:5000, WB:1:500-1:2000, IHC:1:5-1:20

IL23R Antibody

CSB-PA011639KA01HU-
EUR 335
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against IL23R. Recognizes IL23R from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

IL23R Antibody

CSB-PA011639KA01HU-100ul 100ul
EUR 389
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against IL23R. Recognizes IL23R from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

IL23R Antibody

ABD6501 100 ug
EUR 438

IL23R Conjugated Antibody

C32341 100ul
EUR 397

IL23R Conjugated Antibody

C31023 100ul
EUR 397

Anti-IL23R antibody

STJ24181 100 µl
EUR 277
Description: The protein encoded by this gene is a subunit of the receptor for IL23A/IL23. This protein pairs with the receptor molecule IL12RB1/IL12Rbeta1, and both are required for IL23A signaling. This protein associates constitutively with Janus kinase 2 (JAK2), and also binds to transcription activator STAT3 in a ligand-dependent manner.

Anti-IL23R antibody

STJ192311 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to IL23R

Interleukin 23 Receptor (IL23R) Polyclonal Antibody (Rat)

4-PAE765Ra01
  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL23R (Ile25~Leu355)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 23 Receptor (IL23R)

IL23R siRNA

20-abx920488
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

IL23R siRNA

20-abx920489
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

IL23R Antibody, HRP conjugated

1-CSB-PA733162LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IL23R. Recognizes IL23R from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

IL23R Antibody, FITC conjugated

1-CSB-PA733162LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IL23R. Recognizes IL23R from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

IL23R Antibody, Biotin conjugated

1-CSB-PA733162LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IL23R. Recognizes IL23R from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Interleukin 23 Receptor (IL23R) Polyclonal Antibody (Rat), APC

4-PAE765Ra01-APC
  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL23R (Ile25~Leu355)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 23 Receptor (IL23R). This antibody is labeled with APC.

Interleukin 23 Receptor (IL23R) Polyclonal Antibody (Rat), Biotinylated

4-PAE765Ra01-Biotin
  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL23R (Ile25~Leu355)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 23 Receptor (IL23R). This antibody is labeled with Biotin.

Interleukin 23 Receptor (IL23R) Polyclonal Antibody (Rat), Cy3

4-PAE765Ra01-Cy3
  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL23R (Ile25~Leu355)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 23 Receptor (IL23R). This antibody is labeled with Cy3.

Interleukin 23 Receptor (IL23R) Polyclonal Antibody (Rat), FITC

4-PAE765Ra01-FITC
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL23R (Ile25~Leu355)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 23 Receptor (IL23R). This antibody is labeled with FITC.

Interleukin 23 Receptor (IL23R) Polyclonal Antibody (Rat), HRP

4-PAE765Ra01-HRP
  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL23R (Ile25~Leu355)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 23 Receptor (IL23R). This antibody is labeled with HRP.

Interleukin 23 Receptor (IL23R) Polyclonal Antibody (Rat), PE

4-PAE765Ra01-PE
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL23R (Ile25~Leu355)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 23 Receptor (IL23R). This antibody is labeled with PE.

IL23R Blocking Peptide

DF6501-BP 1mg
EUR 195

IL23R cloning plasmid

CSB-CL733162HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 684
  • Sequence: atgaaaaacagcaatgttgtgaaaatgctacaggaaaatagtgaacttatgaataataattccagtgagcaggtcctatatgttgatcccatgattacagagataaaagaaatcttcatcccagaacacaagcctacagactacaagaaggagaatacaggacccctggagacaag
  • Show more
Description: A cloning plasmid for the IL23R gene.

Anti-IL23 Receptor/Il23r Antibody

A00607-1 100ug/vial
EUR 294

Interleukin 23 Receptor (IL23R) Antibody

20-abx177153
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Interleukin 23 Receptor (IL23R) Antibody

20-abx211433
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Interleukin 23 Receptor (IL23R) Antibody

20-abx211458
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Interleukin 23 Receptor (IL23R) Antibody

abx117124-100ug 100 ug
EUR 467
  • Shipped within 5-10 working days.

Interleukin 23 Receptor (IL23R) Antibody

abx038078-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Interleukin 23 Receptor (IL23R) Antibody

20-abx130103
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Interleukin 23 Receptor (IL23R) Antibody

20-abx173141
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Interleukin 23 Receptor (IL23R) Antibody

20-abx173142
  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Interleukin 23 Receptor (IL23R) Antibody

abx029221-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Interleukin 23 Receptor (IL23R) Antibody

abx029221-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Interleukin 23 Receptor (IL23R) Antibody

20-abx318211
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Interleukin 23 Receptor (IL23R) Antibody

20-abx001357
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Interleukin 23 Receptor (IL23R) Polyclonal Antibody (Rat), APC-Cy7

4-PAE765Ra01-APC-Cy7
  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL23R (Ile25~Leu355)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 23 Receptor (IL23R). This antibody is labeled with APC-Cy7.

Interleukin 23 Receptor (IL23R) Antibody (HRP)

20-abx315055
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Interleukin 23 Receptor (IL23R) Antibody (FITC)

20-abx315056
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Interleukin 23 Receptor (IL23R) Antibody (Biotin)

20-abx315057
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

IL23R ELISA KIT|Human

EF005147 96 Tests
EUR 689

Human IL23R shRNA Plasmid

20-abx965609
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse IL23R shRNA Plasmid

20-abx980628
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Monoclonal IL23R Antibody (monoclonal) (M01), Clone: 3D7

APR16851G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human IL23R (monoclonal) (M01). The antibodies are raised in mouse and are from clone 3D7. This antibody is applicable in WB, E

IL23R ORF Vector (Human) (pORF)

ORF005340 1.0 ug DNA
EUR 95

Il23r ORF Vector (Mouse) (pORF)

ORF047869 1.0 ug DNA
EUR 506

IL23R ELISA Kit (Human) (OKBB01127)

OKBB01127 96 Wells
EUR 544
Description: Description of target: Interleukin-23 subunit alpha is a protein that in humans is encoded by the IL23A gene. The protein encoded by this gene is a subunit of the receptor for IL23A/IL23. This protein pairs with the receptor molecule IL12RB1/IL12Rbeta1, and both are required for IL23A signaling. This protein associates constitutively with Janus kinase 2 (JAK2), and also binds to transcription activator STAT3 in a ligand-dependent manner.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

Il23r ELISA Kit (Mouse) (OKBB01128)

OKBB01128 96 Wells
EUR 505
Description: Description of target: Interleukin-23 subunit alpha is a protein that in humans is encoded by the IL23A gene. The protein encoded by this gene is a subunit of the receptor for IL23A/IL23. This protein pairs with the receptor molecule IL12RB1/IL12Rbeta1, and both are required for IL23A signaling. This protein associates constitutively with Janus kinase 2 (JAK2), and also binds to transcription activator STAT3 in a ligand-dependent manner.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

IL23R ELISA Kit (Mouse) (OKCA01701)

OKCA01701 96 Wells
EUR 846
Description: Description of target: Associates with IL12RB1 to form the interleukin-23 receptor. Binds IL23 and mediates T-cells, NK cells and possibly certain macrophage/myeloid cells stimulation probably through activation of the Jak-Stat signaling cascade. IL23 functions in innate and adaptive immunity and may participate in acute response to infection in peripheral tissues. IL23 may be responsible for autoimmune inflammatory diseases and be important for tumorigenesis.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 7.8 pg/mL

IL23R ELISA Kit (Human) (OKCD08697)

OKCD08697 96 Wells
EUR 975
Description: Description of target: The protein encoded by this gene is a subunit of the receptor for IL23A/IL23. This protein pairs with the receptor molecule IL12RB1/IL12Rbeta1, and both are required for IL23A signaling. This protein associates constitutively with Janus kinase 2 (JAK2), and also binds to transcription activator STAT3 in a ligand-dependent manner.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.059ng/mL

IL23R Rabbit Polyclonal Antibody

Recent Posts

Categories

January 2022
M T W T F S S
 12
3456789
10111213141516
17181920212223
24252627282930
31  

Pages