Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG

fallback-image

ROBO4 Rabbit Polyclonal Antibody

ROBO4 Rabbit Polyclonal Antibody

Contact us: [email protected]

ROBO4 Polyclonal Antibody
ABP60228-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human ROBO4 protein
  • Applications tips:
Description: A polyclonal antibody for detection of ROBO4 from Human, Mouse, Rat. This ROBO4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ROBO4 protein
ROBO4 Polyclonal Antibody
ABP60228-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human ROBO4 protein
  • Applications tips:
Description: A polyclonal antibody for detection of ROBO4 from Human, Mouse, Rat. This ROBO4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ROBO4 protein
ROBO4 Polyclonal Antibody
ES11129-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ROBO4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
ROBO4 Polyclonal Antibody
ES11129-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ROBO4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
Human Roundabout Homolog 4 (ROBO4) ELISA Kit
DLR-ROBO4-Hu-48T 48T
EUR 517
  • Should the Human Roundabout Homolog 4 (ROBO4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Roundabout Homolog 4 (ROBO4) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Roundabout Homolog 4 (ROBO4) ELISA Kit
DLR-ROBO4-Hu-96T 96T
EUR 673
  • Should the Human Roundabout Homolog 4 (ROBO4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Roundabout Homolog 4 (ROBO4) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Roundabout Homolog 4 (ROBO4) ELISA Kit
RDR-ROBO4-Hu-48Tests 48 Tests
EUR 544
Human Roundabout Homolog 4 (ROBO4) ELISA Kit
RDR-ROBO4-Hu-96Tests 96 Tests
EUR 756
Human Roundabout Homolog 4 (ROBO4) ELISA Kit
RD-ROBO4-Hu-48Tests 48 Tests
EUR 521
Human Roundabout Homolog 4 (ROBO4) ELISA Kit
RD-ROBO4-Hu-96Tests 96 Tests
EUR 723
ROBO4 Rabbit pAb
A14134-100ul 100 ul
EUR 308
ROBO4 Rabbit pAb
A14134-200ul 200 ul
EUR 459
ROBO4 Rabbit pAb
A14134-20ul 20 ul
EUR 183
ROBO4 Rabbit pAb
A14134-50ul 50 ul
EUR 223
ROBO4 Rabbit pAb
A9876-100ul 100 ul
EUR 308
ROBO4 Rabbit pAb
A9876-200ul 200 ul
EUR 459
ROBO4 Rabbit pAb
A9876-20ul 20 ul
EUR 183
ROBO4 Rabbit pAb
A9876-50ul 50 ul
EUR 223
ROBO4 antibody
70R-21677 50 ul
EUR 435
Description: Rabbit polyclonal ROBO4 antibody
ROBO4 Antibody
3625-100
EUR 338
ROBO4 Antibody
3625-30T
EUR 146
ROBO4 Antibody
40084-100ul 100ul
EUR 252
ROBO4 Antibody
1-CSB-PA845177ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against ROBO4. Recognizes ROBO4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
ROBO4 Antibody
1-CSB-PA121728
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ROBO4. Recognizes ROBO4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100
ROBO4 Antibody
1-CSB-PA903544
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ROBO4. Recognizes ROBO4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100
ROBO4 Antibody
1-CSB-PA020057GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against ROBO4. Recognizes ROBO4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB
ROBO4 Conjugated Antibody
C40084 100ul
EUR 397
ROBO4-Specific Antibody
abx237375-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Anti-ROBO4 antibody
STJ111918 100 µl
EUR 277
Anti-ROBO4 antibody
STJ116069 100 µl
EUR 277
Anti-ROBO4 antibody
STJ192287 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ROBO4
ROBO4 siRNA
20-abx904631
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
ROBO4 siRNA
20-abx931835
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
ROBO4 siRNA
20-abx931836
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti- ROBO4-Specific antibody
FNab07375 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:1000
  • Immunogen: roundabout homolog 4, magic roundabout(Drosophila)
  • Uniprot ID: Q8WZ75
  • Research Area: Immunology, Cardiovascular, Developmental biology
Description: Antibody raised against ROBO4-Specific
Anti-ROBO4-Specific antibody
PAab07375 100 ug
EUR 386
ROBO4 Blocking Peptide
3625BP-50
EUR 153
ROBO4 cloning plasmid
CSB-CL845177HU-10ug 10ug
EUR 1087
  • Formulation: 10 ĂŽÂĽg plasmid + 200ĂŽÂĽl Glycerol
  • Length: 3024
  • Sequence: ATGGGCTCTGGAGGAGACAGCCTCCTGGGGGGCAGGGGTTCCCTGCCTCTGCTGCTCCTGCTCATCATGGGAGGCATGGCTCAGGACTCCCCGCCCCAGATCCTAGTCCACCCCCAGGACCAGCTGTTCCAGGGCCCTGGCCCTGCCAGGATGAGCTGCCAAGCCTCAGGCCAGC
  • Show more
Description: A cloning plasmid for the ROBO4 gene.
Roundabout homolog 4 (ROBO4) Antibody
20-abx210562
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Roundabout homolog 4 (ROBO4) Antibody
20-abx210563
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Roundabout Homolog 4 (ROBO4) Antibody
20-abx135820
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Roundabout Homolog 4 (ROBO4) Antibody
abx412267-50ug 50 ug
EUR 509
  • Shipped within 1 week.
Roundabout Homolog 4 (ROBO4) Antibody
20-abx321166
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Human ROBO4 ELISA Kit
ELA-E3273h 96 Tests
EUR 824
ROBO4 ELISA KIT|Human
EF006327 96 Tests
EUR 689
Rat ROBO4 shRNA Plasmid
20-abx989059
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse ROBO4 shRNA Plasmid
20-abx978112
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human ROBO4 shRNA Plasmid
20-abx960120
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Recombinant Human ROBO4 Protein
RP00437 10 ÎĽg
EUR 174
Anti-Robo4-MCC-DM1 ADC
ADC-W-213 1mg Ask for price
Description: This ADC product is comprised of an anti-ROBO4 monoclonal antibody conjugated via a MCC linker to DM1

ROBO4 Rabbit Polyclonal Antibody

Recent Posts

Categories

January 2022
M T W T F S S
 12
3456789
10111213141516
17181920212223
24252627282930
31  

Pages