Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG


MYCL1 Rabbit Polyclonal Antibody

MYCL1 Rabbit Polyclonal Antibody

Contact us: [email protected]

MYCL1 Polyclonal Antibody

ES11269-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MYCL1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Polyclonal MYCL1 Antibody (C-Term)

APR04843G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MYCL1 (C-Term). This antibody is tested and proven to work in the following applications:

anti- MYCL1 antibody

FNab05459 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:1000
  • Immunogen: v-myc myelocytomatosis viral oncogene homolog 1, lung carcinoma derived(avian)
  • Uniprot ID: P12524
  • Research Area: cancer
Description: Antibody raised against MYCL1

Anti-MYCL1 antibody

PAab05459 100 ug
EUR 386

Anti-MYCL1 antibody

STJ192427 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to MYCL1

MYCL1 cloning plasmid

CSB-CL015274HU-10ug 10ug
EUR 283
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 621
  • Sequence: atggactacgactcgtaccagcactatttctacgactatgactgcggggaggatttctaccgctccacggcgcccagcgaggacatctggaagaaattcgagctggtgccatcgccccccacgtcgccgccctggggcttgggtcccggcgcaggggacccggcccccgggattgg
  • Show more
Description: A cloning plasmid for the MYCL1 gene.


EF001016 96 Tests
EUR 689

MYCL1 Recombinant Protein (Human)

RP020458 100 ug Ask for price

MYCL1 Recombinant Protein (Mouse)

RP152510 100 ug Ask for price

MYCL1 Recombinant Protein (Rat)

RP212891 100 ug Ask for price

Mycl1 ORF Vector (Rat) (pORF)

ORF070965 1.0 ug DNA
EUR 506

MYCL1 ORF Vector (Human) (pORF)

ORF006820 1.0 ug DNA
EUR 95

Mycl1 ORF Vector (Mouse) (pORF)

ORF050838 1.0 ug DNA
EUR 506

MYCL Proto-Oncogene, BHLH Transcription Factor (MYCL1) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

MYCL Proto-Oncogene, BHLH Transcription Factor (MYCL1) Antibody

abx235459-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Mycl1 sgRNA CRISPR Lentivector set (Rat)

K6659001 3 x 1.0 ug
EUR 339

Mycl1 sgRNA CRISPR Lentivector set (Mouse)

K3924501 3 x 1.0 ug
EUR 339

MYCL1 sgRNA CRISPR Lentivector set (Human)

K1372301 3 x 1.0 ug
EUR 339

Mycl1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6659002 1.0 ug DNA
EUR 154

Mycl1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6659003 1.0 ug DNA
EUR 154

Mycl1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6659004 1.0 ug DNA
EUR 154

Mycl1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3924502 1.0 ug DNA
EUR 154

Mycl1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3924503 1.0 ug DNA
EUR 154

Mycl1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3924504 1.0 ug DNA
EUR 154

MYCL1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1372302 1.0 ug DNA
EUR 154

MYCL1 sgRNA CRISPR Lentivector (Human) (Target 2)

K1372303 1.0 ug DNA
EUR 154

MYCL1 sgRNA CRISPR Lentivector (Human) (Target 3)

K1372304 1.0 ug DNA
EUR 154

MYCL1 Protein Vector (Mouse) (pPB-C-His)

PV203350 500 ng
EUR 603

MYCL1 Protein Vector (Mouse) (pPB-N-His)

PV203351 500 ng
EUR 603

MYCL1 Protein Vector (Mouse) (pPM-C-HA)

PV203352 500 ng
EUR 603

MYCL1 Protein Vector (Mouse) (pPM-C-His)

PV203353 500 ng
EUR 603

MYCL1 Protein Vector (Rat) (pPB-C-His)

PV283858 500 ng
EUR 603

MYCL1 Protein Vector (Rat) (pPB-N-His)

PV283859 500 ng
EUR 603

MYCL1 Protein Vector (Rat) (pPM-C-HA)

PV283860 500 ng
EUR 603

MYCL1 Protein Vector (Rat) (pPM-C-His)

PV283861 500 ng
EUR 603

MYCL1 Protein Vector (Human) (pPB-C-His)

PV027277 500 ng
EUR 329

MYCL1 Protein Vector (Human) (pPB-N-His)

PV027278 500 ng
EUR 329

MYCL1 Protein Vector (Human) (pPM-C-HA)

PV027279 500 ng
EUR 329

MYCL1 Protein Vector (Human) (pPM-C-His)

PV027280 500 ng
EUR 329

Mycl1 3'UTR Luciferase Stable Cell Line

TU113688 1.0 ml Ask for price

Mycl1 3'UTR GFP Stable Cell Line

TU163688 1.0 ml Ask for price

Mycl1 3'UTR Luciferase Stable Cell Line

TU213608 1.0 ml Ask for price

Mycl1 3'UTR GFP Stable Cell Line

TU263608 1.0 ml Ask for price

MYCL1 3'UTR GFP Stable Cell Line

TU065018 1.0 ml
EUR 1521

MYCL1 3'UTR Luciferase Stable Cell Line

TU015018 1.0 ml
EUR 1521

V-Myc Myelocytomatosis Viral Oncogene Homolog 1, Lung Carcinoma Derived (MYCL1) Polyclonal Antibody (Human)

  • EUR 262.00
  • EUR 2747.00
  • EUR 679.00
  • EUR 331.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYCL1 (Glu257~Tyr394)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human V-Myc Myelocytomatosis Viral Oncogene Homolog 1, Lung Carcinoma Derived (MYCL1)

V-Myc Myelocytomatosis Viral Oncogene Homolog 1, Lung Carcinoma Derived (MYCL1) Polyclonal Antibody (Human), APC

  • EUR 368.00
  • EUR 3599.00
  • EUR 993.00
  • EUR 472.00
  • EUR 229.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYCL1 (Glu257~Tyr394)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human V-Myc Myelocytomatosis Viral Oncogene Homolog 1, Lung Carcinoma Derived (MYCL1). This antibody is labeled with APC.

V-Myc Myelocytomatosis Viral Oncogene Homolog 1, Lung Carcinoma Derived (MYCL1) Polyclonal Antibody (Human), Biotinylated

  • EUR 328.00
  • EUR 2697.00
  • EUR 786.00
  • EUR 404.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYCL1 (Glu257~Tyr394)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human V-Myc Myelocytomatosis Viral Oncogene Homolog 1, Lung Carcinoma Derived (MYCL1). This antibody is labeled with Biotin.

V-Myc Myelocytomatosis Viral Oncogene Homolog 1, Lung Carcinoma Derived (MYCL1) Polyclonal Antibody (Human), Cy3

  • EUR 449.00
  • EUR 4757.00
  • EUR 1283.00
  • EUR 588.00
  • EUR 264.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYCL1 (Glu257~Tyr394)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human V-Myc Myelocytomatosis Viral Oncogene Homolog 1, Lung Carcinoma Derived (MYCL1). This antibody is labeled with Cy3.

V-Myc Myelocytomatosis Viral Oncogene Homolog 1, Lung Carcinoma Derived (MYCL1) Polyclonal Antibody (Human), FITC

  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYCL1 (Glu257~Tyr394)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human V-Myc Myelocytomatosis Viral Oncogene Homolog 1, Lung Carcinoma Derived (MYCL1). This antibody is labeled with FITC.

V-Myc Myelocytomatosis Viral Oncogene Homolog 1, Lung Carcinoma Derived (MYCL1) Polyclonal Antibody (Human), HRP

  • EUR 335.00
  • EUR 3135.00
  • EUR 877.00
  • EUR 426.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYCL1 (Glu257~Tyr394)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human V-Myc Myelocytomatosis Viral Oncogene Homolog 1, Lung Carcinoma Derived (MYCL1). This antibody is labeled with HRP.

V-Myc Myelocytomatosis Viral Oncogene Homolog 1, Lung Carcinoma Derived (MYCL1) Polyclonal Antibody (Human), PE

  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYCL1 (Glu257~Tyr394)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human V-Myc Myelocytomatosis Viral Oncogene Homolog 1, Lung Carcinoma Derived (MYCL1). This antibody is labeled with PE.

Human Protein L- Myc- 1, MYCL1 ELISA KIT

ELI-16624h 96 Tests
EUR 824

Mouse Protein L- Myc- 1, Mycl1 ELISA KIT

ELI-42386m 96 Tests
EUR 865

MYCL1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV622249 1.0 ug DNA
EUR 682

MYCL1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV622253 1.0 ug DNA
EUR 682

MYCL1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV622254 1.0 ug DNA
EUR 682

V-Myc Myelocytomatosis Viral Oncogene Homolog 1, Lung Carcinoma Derived (MYCL1) Polyclonal Antibody (Human), APC-Cy7

  • EUR 616.00
  • EUR 7078.00
  • EUR 1867.00
  • EUR 824.00
  • EUR 338.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYCL1 (Glu257~Tyr394)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human V-Myc Myelocytomatosis Viral Oncogene Homolog 1, Lung Carcinoma Derived (MYCL1). This antibody is labeled with APC-Cy7.

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

MYCL1 Rabbit Polyclonal Antibody

Recent Posts


January 2022
