Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG

fallback-image

IRGM Rabbit Polyclonal Antibody

IRGM Rabbit Polyclonal Antibody

Contact us: [email protected]

IRGM Polyclonal Antibody

ABP58965-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human IRGM protein at amino acid sequence of 101-150
  • Applications tips:
Description: A polyclonal antibody for detection of IRGM from Human. This IRGM antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human IRGM protein at amino acid sequence of 101-150

IRGM Polyclonal Antibody

ABP58965-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human IRGM protein at amino acid sequence of 101-150
  • Applications tips:
Description: A polyclonal antibody for detection of IRGM from Human. This IRGM antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human IRGM protein at amino acid sequence of 101-150

IRGM Polyclonal Antibody

ABP58965-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human IRGM protein at amino acid sequence of 101-150
  • Applications tips:
Description: A polyclonal antibody for detection of IRGM from Human. This IRGM antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human IRGM protein at amino acid sequence of 101-150

IRGM Polyclonal Antibody

ES11414-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IRGM from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

IRGM Polyclonal Antibody

ES11414-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IRGM from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

Rabbit Anti Irgm (Internal Region) Polyclonal Antibody

CPBT-66123RI 50 µg
EUR 533

Rabbit Anti Irgm (Internal Region) Polyclonal Antibody

CPBT-66124RI 0.1 mg
EUR 663

Rabbit Anti Irgm (N-Terminal) Polyclonal Antibody

CPBT-66126RI 0.1 mg
EUR 663

IRGM Rabbit pAb

A10968-100ul 100 ul
EUR 308

IRGM Rabbit pAb

A10968-200ul 200 ul
EUR 459

IRGM Rabbit pAb

A10968-20ul 20 ul Ask for price

IRGM Rabbit pAb

A10968-50ul 50 ul Ask for price

IRGM Antibody

24660-100ul 100ul
EUR 390

IRGM Antibody

24661-100ul 100ul
EUR 390

IRGM Antibody

36558-100ul 100ul
EUR 252

IRGM Antibody

1-CSB-PA071110
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against IRGM. Recognizes IRGM from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:50-1:200

IRGM Antibody

1-CSB-PA117915
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against IRGM. Recognizes IRGM from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

IRGM Antibody

1-CSB-PA011827ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against IRGM. Recognizes IRGM from Human. This antibody is Unconjugated. Tested in the following application: ELISA

Polyclonal IRGM Antibody (C-term)

APR08031G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human IRGM (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal IRGM / LRG-47 Antibody (Internal)

APR08028G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human IRGM / LRG-47 (Internal). This antibody is tested and proven to work in the following applications:

Human IRGM Antibody

33388-05111 150 ug
EUR 261

IRGM Conjugated Antibody

C36558 100ul
EUR 397

Anti- IRGM antibody

PAab10968 100 ug
EUR 438

Anti-IRGM antibody

STJ112856 100 µl
EUR 277
Description: This gene encodes a member of the p47 immunity-related GTPase family. The encoded protein may play a role in the innate immune response by regulating autophagy formation in response to intracellular pathogens. Polymorphisms that affect the normal expression of this gene are associated with a susceptibility to Crohn's disease and tuberculosis. Alternative splicing results in multiple transcript variants encoding different isoforms.

Anti-IRGM antibody

STJ192572 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to IRGM

IRGM siRNA

20-abx920817
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

IRGM siRNA

20-abx920818
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Antibody for Human IRGM

SPC-681D 0.1mg
EUR 354
Description: A polyclonal antibody for IRGM from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human IRGM. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This IRGM antibody is unconjugated.

Antibody for Human IRGM

SPC-681D-A390 0.1mg
EUR 401
Description: A polyclonal antibody for IRGM from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human IRGM. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This IRGM antibody is conjugated to ATTO 390.

Antibody for Human IRGM

SPC-681D-A488 0.1mg
EUR 400
Description: A polyclonal antibody for IRGM from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human IRGM. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This IRGM antibody is conjugated to ATTO 488.

Antibody for Human IRGM

SPC-681D-A565 0.1mg
EUR 400
Description: A polyclonal antibody for IRGM from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human IRGM. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This IRGM antibody is conjugated to ATTO 565.

Antibody for Human IRGM

SPC-681D-A594 0.1mg
EUR 400
Description: A polyclonal antibody for IRGM from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human IRGM. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This IRGM antibody is conjugated to ATTO 594.

Antibody for Human IRGM

SPC-681D-A633 0.1mg
EUR 400
Description: A polyclonal antibody for IRGM from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human IRGM. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This IRGM antibody is conjugated to ATTO 633.

Antibody for Human IRGM

SPC-681D-A655 0.1mg
EUR 400
Description: A polyclonal antibody for IRGM from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human IRGM. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This IRGM antibody is conjugated to ATTO 655.

Antibody for Human IRGM

SPC-681D-A680 0.1mg
EUR 400
Description: A polyclonal antibody for IRGM from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human IRGM. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This IRGM antibody is conjugated to ATTO 680.

Antibody for Human IRGM

SPC-681D-A700 0.1mg
EUR 400
Description: A polyclonal antibody for IRGM from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human IRGM. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This IRGM antibody is conjugated to ATTO 700.

Antibody for Human IRGM

SPC-681D-ALP 0.1mg
EUR 394
Description: A polyclonal antibody for IRGM from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human IRGM. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This IRGM antibody is conjugated to Alkaline Phosphatase.

Antibody for Human IRGM

SPC-681D-APC 0.1mg
EUR 399
Description: A polyclonal antibody for IRGM from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human IRGM. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This IRGM antibody is conjugated to APC .

Antibody for Human IRGM

SPC-681D-APCCY7 0.1mg
EUR 471
Description: A polyclonal antibody for IRGM from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human IRGM. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This IRGM antibody is conjugated to APC/Cy7.

Antibody for Human IRGM

SPC-681D-BI 0.1mg
EUR 396
Description: A polyclonal antibody for IRGM from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human IRGM. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This IRGM antibody is conjugated to Biotin.

Antibody for Human IRGM

SPC-681D-DY350 0.1mg
EUR 414
Description: A polyclonal antibody for IRGM from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human IRGM. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This IRGM antibody is conjugated to Dylight 350.

Antibody for Human IRGM

SPC-681D-DY405 0.1mg
EUR 403
Description: A polyclonal antibody for IRGM from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human IRGM. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This IRGM antibody is conjugated to Dylight 405.

Antibody for Human IRGM

SPC-681D-DY488 0.1mg
EUR 393
Description: A polyclonal antibody for IRGM from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human IRGM. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This IRGM antibody is conjugated to Dylight 488.

Antibody for Human IRGM

SPC-681D-DY594 0.1mg
EUR 395
Description: A polyclonal antibody for IRGM from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human IRGM. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This IRGM antibody is conjugated to Dylight 594.

Antibody for Human IRGM

SPC-681D-DY633 0.1mg
EUR 390
Description: A polyclonal antibody for IRGM from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human IRGM. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This IRGM antibody is conjugated to Dylight 633.

Antibody for Human IRGM

SPC-681D-FITC 0.1mg
EUR 392
Description: A polyclonal antibody for IRGM from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human IRGM. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This IRGM antibody is conjugated to FITC.

Antibody for Human IRGM

SPC-681D-HRP 0.1mg
EUR 388
Description: A polyclonal antibody for IRGM from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human IRGM. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This IRGM antibody is conjugated to HRP.

Antibody for Human IRGM

SPC-681D-P594 0.1mg
EUR 407
Description: A polyclonal antibody for IRGM from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human IRGM. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This IRGM antibody is conjugated to PE/ATTO 594.

Antibody for Human IRGM

SPC-681D-PCP 0.1mg
EUR 399
Description: A polyclonal antibody for IRGM from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human IRGM. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This IRGM antibody is conjugated to PerCP.

Antibody for Human IRGM

SPC-681D-RPE 0.1mg
EUR 397
Description: A polyclonal antibody for IRGM from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human IRGM. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This IRGM antibody is conjugated to RPE .

Antibody for Human IRGM

SPC-681D-STR 0.1mg
EUR 398
Description: A polyclonal antibody for IRGM from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human IRGM. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This IRGM antibody is conjugated to Streptavidin.

Antibody for Human IRGM

SPC-681S 0.012mg
EUR 65
Description: A polyclonal antibody for IRGM from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human IRGM. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This IRGM antibody is unconjugated.

IRGM cloning plasmid

CSB-CL011827HU-10ug 10ug
EUR 259
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 537
  • Sequence: ATGAATGTTGAGAAAGCCTCAGCAGATGGGAACTTGCCAGAGGTGATCTCTAACATCAAGGAGACTCTGAAGATAGTGTCCAGGACACCAGTTAACATCACTATGGCAGGGGACTCTGGCAATGGGATGTCCACCTTCATCAGTGCCCTTCGAAACACAGGACATGAGGGTAAGGC
  • Show more
Description: A cloning plasmid for the IRGM gene.

Human IRGM Antibody (Biotin Conjugate)

33388-05121 150 ug
EUR 369

IRGM protein (His tag)

80R-2611 100 ug
EUR 322
Description: Purified recombinant IRGM protein

Rat IRGM shRNA Plasmid

20-abx989174
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human IRGM shRNA Plasmid

20-abx967469
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pCR-BluntII-TOPO-IRGM

PVT19166 2 ug
EUR 231

IRGM Recombinant Protein (Human)

RP040150 100 ug Ask for price

IRGM Recombinant Protein (Rat)

RP206258 100 ug Ask for price

Human IRGM AssayLite Antibody (FITC Conjugate)

33388-05141 150 ug
EUR 428

Human IRGM AssayLite Antibody (RPE Conjugate)

33388-05151 150 ug
EUR 428

Human IRGM AssayLite Antibody (APC Conjugate)

33388-05161 150 ug
EUR 428

Human IRGM AssayLite Antibody (PerCP Conjugate)

33388-05171 150 ug
EUR 471

Immunity Related GTPase M (IRGM) Antibody

abx412110-01mg 0.1 mg
EUR 537
  • Shipped within 1 week.

Irgm ORF Vector (Rat) (pORF)

ORF068754 1.0 ug DNA
EUR 506

IRGM ORF Vector (Human) (pORF)

ORF013384 1.0 ug DNA
EUR 354

Immunity-Related GTPase Family M Protein (IRGM) Antibody

abx026104-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Immunity-Related GTPase Family M Protein (IRGM) Antibody

abx026104-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Immunity-Related GTPase Family M Protein (IRGM) Antibody

20-abx210849
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Immunity-Related GTPase Family M Protein (IRGM) Antibody

20-abx126951
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Immunity-Related GTPase Family M Protein (IRGM) Antibody

20-abx339551
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Immunity-Related GTPase Family M Protein (IRGM) Antibody

20-abx321743
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Immunity-Related GTPase Family M Protein (IRGM) Antibody

abx448534-100ug 100 ug
EUR 523
  • Shipped within 5-12 working days.

Irgm sgRNA CRISPR Lentivector set (Rat)

K6649901 3 x 1.0 ug
EUR 339

IRGM sgRNA CRISPR Lentivector set (Human)

K1099401 3 x 1.0 ug
EUR 339

Immunity-Related GTPase Family M Protein (IRGM) Antibody (ALP)

abx448005-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Immunity-Related GTPase Family M Protein (IRGM) Antibody (APC)

abx448006-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Immunity-Related GTPase Family M Protein (IRGM) Antibody (Biotin)

abx448007-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Immunity-Related GTPase Family M Protein (IRGM) Antibody (FITC)

abx448008-100ug 100 ug
EUR 565
  • Shipped within 5-12 working days.

Immunity-Related GTPase Family M Protein (IRGM) Antibody (HRP)

abx448009-100ug 100 ug
EUR 565
  • Shipped within 5-12 working days.

Immunity-Related GTPase Family M Protein (IRGM) Antibody (PerCP)

abx448011-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Immunity-Related GTPase Family M Protein (IRGM) Antibody (RPE)

abx448012-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Immunity-Related GTPase Family M Protein (IRGM) Antibody (Streptavidin)

abx448013-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Irgm sgRNA CRISPR Lentivector (Rat) (Target 1)

K6649902 1.0 ug DNA
EUR 154

Irgm sgRNA CRISPR Lentivector (Rat) (Target 2)

K6649903 1.0 ug DNA
EUR 154

Irgm sgRNA CRISPR Lentivector (Rat) (Target 3)

K6649904 1.0 ug DNA
EUR 154

IRGM sgRNA CRISPR Lentivector (Human) (Target 1)

K1099402 1.0 ug DNA
EUR 154

IRGM sgRNA CRISPR Lentivector (Human) (Target 2)

K1099403 1.0 ug DNA
EUR 154

IRGM sgRNA CRISPR Lentivector (Human) (Target 3)

K1099404 1.0 ug DNA
EUR 154

IRGM Protein Vector (Rat) (pPB-C-His)

PV275014 500 ng
EUR 603

IRGM Protein Vector (Rat) (pPB-N-His)

PV275015 500 ng
EUR 603

IRGM Protein Vector (Rat) (pPM-C-HA)

PV275016 500 ng
EUR 603

IRGM Protein Vector (Rat) (pPM-C-His)

PV275017 500 ng
EUR 603

IRGM Protein Vector (Human) (pPB-C-His)

PV053533 500 ng
EUR 481

IRGM Protein Vector (Human) (pPB-N-His)

PV053534 500 ng
EUR 481

IRGM Protein Vector (Human) (pPM-C-HA)

PV053535 500 ng
EUR 481

IRGM Protein Vector (Human) (pPM-C-His)

PV053536 500 ng
EUR 481

IRGM Rabbit Polyclonal Antibody

Recent Posts

Categories

January 2022
M T W T F S S
 12
3456789
10111213141516
17181920212223
24252627282930
31  

Pages