Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG

fallback-image

MEPE Rabbit Polyclonal Antibody

MEPE Rabbit Polyclonal Antibody

Contact us: [email protected]

MEPE Polyclonal Antibody
ES11308-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEPE from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit
DLR-MEPE-Hu-48T 48T
EUR 498
  • Should the Human Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Matrix Extracellular Phosphoglycoprotein (MEPE) in samples from serum, plasma or other biological fluids.

Human Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit
DLR-MEPE-Hu-96T 96T
EUR 647
  • Should the Human Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Matrix Extracellular Phosphoglycoprotein (MEPE) in samples from serum, plasma or other biological fluids.

Mouse Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit
DLR-MEPE-Mu-48T 48T
EUR 508
  • Should the Mouse Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Matrix Extracellular Phosphoglycoprotein (MEPE) in samples from serum, plasma or other biological fluids.

Mouse Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit
DLR-MEPE-Mu-96T 96T
EUR 661
  • Should the Mouse Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Matrix Extracellular Phosphoglycoprotein (MEPE) in samples from serum, plasma or other biological fluids.

Rat Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit
DLR-MEPE-Ra-48T 48T
EUR 528
  • Should the Rat Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Matrix Extracellular Phosphoglycoprotein (MEPE) in samples from serum, plasma or other biological fluids.

Rat Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit
DLR-MEPE-Ra-96T 96T
EUR 690
  • Should the Rat Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Matrix Extracellular Phosphoglycoprotein (MEPE) in samples from serum, plasma or other biological fluids.

Human Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit
RDR-MEPE-Hu-48Tests 48 Tests
EUR 522

Human Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit
RDR-MEPE-Hu-96Tests 96 Tests
EUR 724

Mouse Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit
RDR-MEPE-Mu-48Tests 48 Tests
EUR 534

Mouse Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit
RDR-MEPE-Mu-96Tests 96 Tests
EUR 742

Rat Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit
RDR-MEPE-Ra-48Tests 48 Tests
EUR 558

Rat Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit
RDR-MEPE-Ra-96Tests 96 Tests
EUR 776

Human Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit
RD-MEPE-Hu-48Tests 48 Tests
EUR 500

Human Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit
RD-MEPE-Hu-96Tests 96 Tests
EUR 692

Mouse Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit
RD-MEPE-Mu-48Tests 48 Tests
EUR 511

Mouse Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit
RD-MEPE-Mu-96Tests 96 Tests
EUR 709

Rat Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit
RD-MEPE-Ra-48Tests 48 Tests
EUR 534

Rat Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit
RD-MEPE-Ra-96Tests 96 Tests
EUR 742

MEPE antibody
70R-18478 50 ul
EUR 435
Description: Rabbit polyclonal MEPE antibody

MEPE antibody
70R-8188 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal MEPE antibody

MEPE Antibody
1-CSB-PA013704GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against MEPE. Recognizes MEPE from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Rabbit MEPE ELISA Kit
ERTM0266 96Tests
EUR 521

anti- MEPE antibody
FNab05128 100µg
EUR 585
  • Immunogen: matrix extracellular phosphoglycoprotein
  • Uniprot ID: Q9NQ76
  • Gene ID: 56955
  • Research Area: Stem Cells, Cardiovascular
Description: Antibody raised against MEPE

anti- MEPE antibody
FNab05129 100µg
EUR 585
  • Immunogen: matrix extracellular phosphoglycoprotein
  • Uniprot ID: Q9NQ76
  • Gene ID: 56955
  • Research Area: Stem Cells, Cardiovascular
Description: Antibody raised against MEPE

Anti-MEPE antibody
PAab05128 100 ug
EUR 412

Anti-MEPE antibody
PAab05129 100 ug
EUR 412

Anti-MEPE antibody
STJ192466 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to MEPE

Matrix Extracellular Phosphoglycoprotein (MEPE) Polyclonal Antibody (Human)
4-PAB232Hu01
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MEPE (Ser212~Asn445)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Matrix Extracellular Phosphoglycoprotein (MEPE)

Matrix Extracellular Phosphoglycoprotein (MEPE) Polyclonal Antibody (Rat)
4-PAB232Ra01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MEPE (Gly28~Ser224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Matrix Extracellular Phosphoglycoprotein (MEPE)

MEPE siRNA
20-abx923938
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Matrix Extracellular Phosphoglycoprotein (MEPE) Polyclonal Antibody (Human), APC
4-PAB232Hu01-APC
  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MEPE (Ser212~Asn445)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Matrix Extracellular Phosphoglycoprotein (MEPE). This antibody is labeled with APC.

Matrix Extracellular Phosphoglycoprotein (MEPE) Polyclonal Antibody (Human), Biotinylated
4-PAB232Hu01-Biotin
  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MEPE (Ser212~Asn445)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Matrix Extracellular Phosphoglycoprotein (MEPE). This antibody is labeled with Biotin.

Matrix Extracellular Phosphoglycoprotein (MEPE) Polyclonal Antibody (Human), Cy3
4-PAB232Hu01-Cy3
  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MEPE (Ser212~Asn445)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Matrix Extracellular Phosphoglycoprotein (MEPE). This antibody is labeled with Cy3.

Matrix Extracellular Phosphoglycoprotein (MEPE) Polyclonal Antibody (Human), FITC
4-PAB232Hu01-FITC
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MEPE (Ser212~Asn445)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Matrix Extracellular Phosphoglycoprotein (MEPE). This antibody is labeled with FITC.

Matrix Extracellular Phosphoglycoprotein (MEPE) Polyclonal Antibody (Human), HRP
4-PAB232Hu01-HRP
  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MEPE (Ser212~Asn445)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Matrix Extracellular Phosphoglycoprotein (MEPE). This antibody is labeled with HRP.

Matrix Extracellular Phosphoglycoprotein (MEPE) Polyclonal Antibody (Human), PE
4-PAB232Hu01-PE
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MEPE (Ser212~Asn445)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Matrix Extracellular Phosphoglycoprotein (MEPE). This antibody is labeled with PE.

Matrix Extracellular Phosphoglycoprotein (MEPE) Polyclonal Antibody (Rat), APC
4-PAB232Ra01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MEPE (Gly28~Ser224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Matrix Extracellular Phosphoglycoprotein (MEPE). This antibody is labeled with APC.

Matrix Extracellular Phosphoglycoprotein (MEPE) Polyclonal Antibody (Rat), Biotinylated
4-PAB232Ra01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MEPE (Gly28~Ser224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Matrix Extracellular Phosphoglycoprotein (MEPE). This antibody is labeled with Biotin.

Matrix Extracellular Phosphoglycoprotein (MEPE) Polyclonal Antibody (Rat), Cy3
4-PAB232Ra01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MEPE (Gly28~Ser224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Matrix Extracellular Phosphoglycoprotein (MEPE). This antibody is labeled with Cy3.

Matrix Extracellular Phosphoglycoprotein (MEPE) Polyclonal Antibody (Rat), FITC
4-PAB232Ra01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MEPE (Gly28~Ser224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Matrix Extracellular Phosphoglycoprotein (MEPE). This antibody is labeled with FITC.

Matrix Extracellular Phosphoglycoprotein (MEPE) Polyclonal Antibody (Rat), HRP
4-PAB232Ra01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MEPE (Gly28~Ser224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Matrix Extracellular Phosphoglycoprotein (MEPE). This antibody is labeled with HRP.

Matrix Extracellular Phosphoglycoprotein (MEPE) Polyclonal Antibody (Rat), PE
4-PAB232Ra01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MEPE (Gly28~Ser224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Matrix Extracellular Phosphoglycoprotein (MEPE). This antibody is labeled with PE.

Rabbit Matrix Extracellular Phosphoglycoprotein (MEPE) ELISA Kit
abx363264-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

MEPE Blocking Peptide
33R-5267 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MEPE antibody, catalog no. 70R-8188

MEPE cloning plasmid
CSB-CL013704HU-10ug 10ug
EUR 552
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1578
  • Sequence: ATGCGAGTTTTCTGTGTGGGACTACTCCTTTTCAGTGTGACCTGGGCAGCACCAACATTTCAACCACAGACTGAGAAAACTAAGCAAAGCTGTGTGGAAGAGCAGAGGCAGGAAGAAAAAAACAAAGACAATATTGGTTTTCACCATTTGGGCAAGAGAATAAATCAAGAGCTAT
  • Show more
Description: A cloning plasmid for the MEPE gene.

Matrix Extracellular Phosphoglycoprotein (MEPE) Antibody
abx026780-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Matrix Extracellular Phosphoglycoprotein (MEPE) Antibody
abx026780-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Matrix Extracellular Phosphoglycoprotein (MEPE) Antibody
20-abx177464
  • EUR 1177.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Matrix Extracellular Phosphoglycoprotein (MEPE) Antibody
20-abx177465
  • EUR 1177.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Matrix Extracellular Phosphoglycoprotein (MEPE) Antibody
20-abx104132
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Matrix Extracellular Phosphoglycoprotein (MEPE) Antibody
20-abx104133
  • EUR 314.00
  • EUR 133.00
  • EUR 829.00
  • EUR 439.00
  • EUR 272.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Matrix Extracellular Phosphoglycoprotein (MEPE) Antibody
20-abx113618
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Matrix Extracellular Phosphoglycoprotein (MEPE) Antibody
20-abx123885
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Matrix Extracellular Phosphoglycoprotein (MEPE) Antibody
20-abx173468
  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.

Matrix Extracellular Phosphoglycoprotein (MEPE) Antibody
20-abx173469
  • EUR 871.00
  • EUR 453.00
  • 1 mg
  • 200 ug
  • Please enquire.

Matrix Extracellular Phosphoglycoprotein (MEPE) Antibody
abx235128-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Matrix Extracellular Phosphoglycoprotein (MEPE) Antibody
abx235129-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

MEPE Rabbit Polyclonal Antibody

Recent Posts

Categories

January 2022
M T W T F S S
 12
3456789
10111213141516
17181920212223
24252627282930
31  

Pages