SALL4 Rabbit Polyclonal Antibody

Contact us: [email protected]

SALL4 Polyclonal Antibody
ABP60322-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human SALL4 protein at amino acid sequence of 891-940 Applications tips:
Description: A polyclonal antibody for detection of SALL4 from Human, Mouse. This SALL4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SALL4 protein at amino acid sequence of 891-940

SALL4 Polyclonal Antibody
ABP60322-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human SALL4 protein at amino acid sequence of 891-940 Applications tips:
Description: A polyclonal antibody for detection of SALL4 from Human, Mouse. This SALL4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SALL4 protein at amino acid sequence of 891-940

SALL4 Polyclonal Antibody
ES11394-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against SALL4 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

SALL4 Polyclonal Antibody
ES11394-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against SALL4 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

SALL4 Rabbit pAb
A16193-100ul	Abclonal	100 ul	EUR 308

SALL4 Rabbit pAb
A16193-200ul	Abclonal	200 ul	EUR 459

SALL4 Rabbit pAb
A16193-20ul	Abclonal	20 ul	EUR 183

SALL4 Rabbit pAb
A16193-50ul	Abclonal	50 ul	EUR 223

SALL4 Rabbit pAb
A7124-100ul	Abclonal	100 ul	EUR 308

SALL4 Rabbit pAb
A7124-200ul	Abclonal	200 ul	EUR 459

SALL4 Rabbit pAb
A7124-20ul	Abclonal	20 ul	EUR 183

SALL4 Rabbit pAb
A7124-50ul	Abclonal	50 ul	EUR 223

SALL4 Rabbit pAb
A5596-100ul	Abclonal	100 ul	EUR 308

SALL4 Rabbit pAb
A5596-200ul	Abclonal	200 ul	EUR 459

SALL4 Rabbit pAb
A5596-20ul	Abclonal	20 ul	Ask for price

SALL4 Rabbit pAb
A5596-50ul	Abclonal	50 ul	Ask for price

Polyclonal SALL4 Antibody (Center)
APR04792G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SALL4 (Center). This antibody is tested and proven to work in the following applications:

Sall4 Antibody
45135-100ul	SAB	100ul	EUR 252

Sall4 Antibody
45135-50ul	SAB	50ul	EUR 187

SALL4 Antibody
1-CSB-PA892126DSR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SALL4. Recognizes SALL4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

Sall4 Antibody
DF7757	Affbiotech	200ul	EUR 304
Description: Sall4 Antibody detects endogenous levels of total Sall4.

Sall4 Antibody
ABD7757	Lifescience Market	100 ug	EUR 438

SALL4 Antibody
P1052-01m	SAB	0.1m	EUR 158

SALL4 Antibody
P1052-1ml	SAB	1ml	EUR 470

Polyclonal SALL4 Antibody (C-term)
APR04764G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SALL4 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal SALL4 Antibody (aa28-42)
APR02192G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SALL4 (aa28-42). This antibody is tested and proven to work in the following applications:

Polyclonal SALL4 Antibody (C-term)
APR14398G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SALL4 (C-term). This antibody is tested and proven to work in the following applications:

Sall4 (anti Sall4 antibody, clone# PPZ0601)
PP-PPZ0601-00	Sceti	0.1mg/100uL	EUR 623
Description: The Sall4 (anti Sall4 antibody, clone# PPZ0601) is available in Europe and for worldwide shipping via Gentaur.

Sal-like 4 (SALL4) polyclonal antibody
ABP-PAB-11688	Allele Biotech	100 ug	Ask for price
Product line: Miscellaneous Brand:

Sall4 Conjugated Antibody
C45135	SAB	100ul	EUR 397

Anti-Sall4 Antibody
A1692-100	Biovision		EUR 479

anti- SALL4 antibody
FNab07583	FN Test	100µg	EUR 585
Immunogen: sal-like 4(Drosophila) Uniprot ID: Q9UJQ4 Gene ID: 57167 Research Area: Metabolism, Immunology, Cancer, Developmental biology, Stem Cells
Description: Antibody raised against SALL4

anti- SALL4 antibody
FNab07584	FN Test	100µg	EUR 585
Recommended dilution: WB: 1:500 - 1:2000 Immunogen: sal-like 4(Drosophila) Uniprot ID: Q9UJQ4 Gene ID: 57167 Research Area: Metabolism, Immunology, Cancer, Developmental biology, Stem Cells
Description: Antibody raised against SALL4

Anti-SALL4 antibody
PAab07583	Lifescience Market	100 ug	EUR 412

Anti-SALL4 antibody
STJ111252	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a zinc finger transcription factor thought to play a role in the development of abducens motor neurons. Defects in this gene are a cause of Duane-radial ray syndrome (DRRS). Alternative splicing results in multiple transcript variants encoding different isoforms.

Anti-SALL4 antibody
STJ118646	St John's Laboratory	100 µl	EUR 277

Anti-SALL4 antibody
STJ160131	St John's Laboratory	1 mL C	EUR 544

Anti-SALL4 antibody
STJ29204	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a zinc finger transcription factor thought to play a role in the development of abducens motor neurons. Defects in this gene are a cause of Duane-radial ray syndrome (DRRS). Alternative splicing results in multiple transcript variants encoding different isoforms.

Anti-SALL4 antibody
STJ192552	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to SALL4

Anti-SALL4 antibody
STJ180237	St John's Laboratory	0.1 ml	EUR 244

SALL4 siRNA
20-abx932410	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SALL4 siRNA
20-abx932411	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-SALL4
YF-PA26465	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to SALL4

Anti-Sall4 (mouse) antibody
STJ71177	St John's Laboratory	100 µg	EUR 359

SALL4 cloning plasmid
CSB-CL892126HU-10ug	Cusabio	10ug	EUR 1164
Formulation: 10 μg plasmid + 200μl Glycerol Length: 3162 Sequence: ATGTCGAGGCGCAAGCAGGCGAAACCCCAGCACATCAACTCGGAGGAGGACCAGGGCGAGCAGCAGCCGCAGCAGCAGACCCCGGAGTTTGCAGATGCGGCCCCAGCGGCGCCCGCGGCGGGGGAGCTGGGTGCTCCAGTGAACCACCCAGGGAATGACGAGGTGGCGAGTGAGG Show more
Description: A cloning plasmid for the SALL4 gene.

Sall4 Blocking Peptide
DF7757-BP	Affbiotech	1mg	EUR 195

Anti-SALL4 (6E3)
YF-MA11603	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to SALL4

Monoclonal SALL4 Antibody, Clone: 1E11A4
AMM03062G	Leading Biology	0.1ml	EUR 528
Description: A Monoclonal antibody against Human SALL4. The antibodies are raised in Mouse and are from clone 1E11A4. This antibody is applicable in WB and IHC, FC, ICC, E

SALL4 ELISA KIT|Human
EF002699	Lifescience Market	96 Tests	EUR 689

Human SALL4 shRNA Plasmid
20-abx961370	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse SALL4 shRNA Plasmid
20-abx979406	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Sal-Like Protein 4 (SALL4) Antibody
20-abx005379	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Sal-Like Protein 4 (SALL4) Antibody
20-abx218433	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Sal-Like Protein 4 (SALL4) Antibody
abx224198-100ug	Abbexa	100 ug	EUR 411
Shipped within 5-10 working days.

Sal-Like Protein 4 (SALL4) Antibody
20-abx127041	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Sal-Like Protein 4 (SALL4) Antibody
abx028391-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Sal-Like Protein 4 (SALL4) Antibody
abx028391-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Sal-Like Protein 4 (SALL4) Antibody
abx237583-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Sal-Like Protein 4 (SALL4) Antibody
abx237584-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Sal-Like Protein 4 (SALL4) Antibody
20-abx320299	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Sal-Like Protein 4 (SALL4) Antibody
abx432248-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

SALL4 (Sal-Like Protein 4)
MO47050	Neuromics	100 ug	EUR 349

SALL4 ORF Vector (Human) (pORF)
ORF014359	ABM	1.0 ug DNA	EUR 354

Sall4 ORF Vector (Mouse) (pORF)
ORF056637	ABM	1.0 ug DNA	EUR 506

Sall4 ORF Vector (Mouse) (pORF)
ORF056638	ABM	1.0 ug DNA	EUR 506

Sall4 ORF Vector (Mouse) (pORF)
ORF056639	ABM	1.0 ug DNA	EUR 506

pECMV-Sall4-m-FLAG Plasmid
PVT15326	Lifescience Market	2 ug	EUR 325

pECMV-Sall4-m-FLAG Plasmid
PVT15756	Lifescience Market	2 ug	EUR 325

SALL4 ELISA Kit (Human) (OKCA00803)
OKCA00803	Aviva Systems Biology	96 Wells	EUR 833
Description: Description of target: Transcription factor with a key role in the maintenance and self-renewal of embryonic and hematopoietic stem cells.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 9.37 pg/mL

Mouse Anti-Human SALL4 monoclonal antibody, clone JID770
CABT-L2858-100uL500uL	Creative Diagnostics	100 uL, 500 uL	EUR 502

Sall4 sgRNA CRISPR Lentivector set (Mouse)
K3781801	ABM	3 x 1.0 ug	EUR 339

SALL4 sgRNA CRISPR Lentivector set (Human)
K2086501	ABM	3 x 1.0 ug	EUR 339

Human Sal Like Protein 4 (SALL4) Protein
20-abx654986	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Sall4 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3781802	ABM	1.0 ug DNA	EUR 154

Sall4 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3781803	ABM	1.0 ug DNA	EUR 154

Sall4 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3781804	ABM	1.0 ug DNA	EUR 154

SALL4 sgRNA CRISPR Lentivector (Human) (Target 1)
K2086502	ABM	1.0 ug DNA	EUR 154

SALL4 sgRNA CRISPR Lentivector (Human) (Target 2)
K2086503	ABM	1.0 ug DNA	EUR 154

SALL4 sgRNA CRISPR Lentivector (Human) (Target 3)
K2086504	ABM	1.0 ug DNA	EUR 154

SALL4 Protein Vector (Human) (pPB-C-His)
PV057433	ABM	500 ng	EUR 329

SALL4 Protein Vector (Human) (pPB-N-His)
PV057434	ABM	500 ng	EUR 481

SALL4 Protein Vector (Human) (pPM-C-HA)
PV057435	ABM	500 ng	EUR 481

SALL4 Protein Vector (Human) (pPM-C-His)
PV057436	ABM	500 ng	EUR 481

SALL4 Protein Vector (Mouse) (pPB-C-His)
PV226546	ABM	500 ng	EUR 603

SALL4 Protein Vector (Mouse) (pPB-N-His)
PV226547	ABM	500 ng	EUR 603

SALL4 Protein Vector (Mouse) (pPM-C-HA)
PV226548	ABM	500 ng	EUR 603

SALL4 Protein Vector (Mouse) (pPM-C-His)
PV226549	ABM	500 ng	EUR 603

SALL4 Protein Vector (Mouse) (pPB-C-His)
PV226550	ABM	500 ng	EUR 1065

SALL4 Protein Vector (Mouse) (pPB-N-His)
PV226551	ABM	500 ng	EUR 1065

SALL4 Protein Vector (Mouse) (pPM-C-HA)
PV226552	ABM	500 ng	EUR 1065

SALL4 Protein Vector (Mouse) (pPM-C-His)
PV226553	ABM	500 ng	EUR 1065

SALL4 Protein Vector (Mouse) (pPB-C-His)
PV226554	ABM	500 ng	EUR 603

SALL4 Protein Vector (Mouse) (pPB-N-His)
PV226555	ABM	500 ng	EUR 603

SALL4 Protein Vector (Mouse) (pPM-C-HA)
PV226556	ABM	500 ng	EUR 603

SALL4 Protein Vector (Mouse) (pPM-C-His)
PV226557	ABM	500 ng	EUR 603

Sall4 3'UTR Luciferase Stable Cell Line
TU118323	ABM	1.0 ml	Ask for price

Sall4 3'UTR GFP Stable Cell Line
TU168323	ABM	1.0 ml	Ask for price

SALL4 3'UTR GFP Stable Cell Line
TU072564	ABM	1.0 ml	EUR 1394

SALL4 3'UTR Luciferase Stable Cell Line
TU022564	ABM	1.0 ml	EUR 1394

SALL4 Rabbit Polyclonal Antibody