Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG

fallback-image

SALL4 Rabbit Polyclonal Antibody

SALL4 Rabbit Polyclonal Antibody

Contact us: [email protected]

SALL4 Polyclonal Antibody
ABP60322-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human SALL4 protein at amino acid sequence of 891-940
  • Applications tips:
Description: A polyclonal antibody for detection of SALL4 from Human, Mouse. This SALL4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SALL4 protein at amino acid sequence of 891-940
SALL4 Polyclonal Antibody
ABP60322-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human SALL4 protein at amino acid sequence of 891-940
  • Applications tips:
Description: A polyclonal antibody for detection of SALL4 from Human, Mouse. This SALL4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SALL4 protein at amino acid sequence of 891-940
SALL4 Polyclonal Antibody
ES11394-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against SALL4 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
SALL4 Polyclonal Antibody
ES11394-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against SALL4 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
SALL4 Rabbit pAb
A16193-100ul 100 ul
EUR 308
SALL4 Rabbit pAb
A16193-200ul 200 ul
EUR 459
SALL4 Rabbit pAb
A16193-20ul 20 ul
EUR 183
SALL4 Rabbit pAb
A16193-50ul 50 ul
EUR 223
SALL4 Rabbit pAb
A7124-100ul 100 ul
EUR 308
SALL4 Rabbit pAb
A7124-200ul 200 ul
EUR 459
SALL4 Rabbit pAb
A7124-20ul 20 ul
EUR 183
SALL4 Rabbit pAb
A7124-50ul 50 ul
EUR 223
SALL4 Rabbit pAb
A5596-100ul 100 ul
EUR 308
SALL4 Rabbit pAb
A5596-200ul 200 ul
EUR 459
SALL4 Rabbit pAb
A5596-20ul 20 ul Ask for price
SALL4 Rabbit pAb
A5596-50ul 50 ul Ask for price
Polyclonal SALL4 Antibody (Center)
APR04792G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SALL4 (Center). This antibody is tested and proven to work in the following applications:
Sall4 Antibody
45135-100ul 100ul
EUR 252
Sall4 Antibody
45135-50ul 50ul
EUR 187
SALL4 Antibody
1-CSB-PA892126DSR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SALL4. Recognizes SALL4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
Sall4 Antibody
DF7757 200ul
EUR 304
Description: Sall4 Antibody detects endogenous levels of total Sall4.
Sall4 Antibody
ABD7757 100 ug
EUR 438
SALL4 Antibody
P1052-01m 0.1m
EUR 158
SALL4 Antibody
P1052-1ml 1ml
EUR 470
Polyclonal SALL4 Antibody (C-term)
APR04764G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SALL4 (C-term). This antibody is tested and proven to work in the following applications:
Polyclonal SALL4 Antibody (aa28-42)
APR02192G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SALL4 (aa28-42). This antibody is tested and proven to work in the following applications:
Polyclonal SALL4 Antibody (C-term)
APR14398G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SALL4 (C-term). This antibody is tested and proven to work in the following applications:
Sall4 (anti Sall4 antibody, clone# PPZ0601)
PP-PPZ0601-00 0.1mg/100uL
EUR 623
Description: The Sall4 (anti Sall4 antibody, clone# PPZ0601) is available in Europe and for worldwide shipping via Gentaur.
Sal-like 4 (SALL4) polyclonal antibody
ABP-PAB-11688 100 ug Ask for price
    • Product line: Miscellaneous
    • Brand:
Sall4 Conjugated Antibody
C45135 100ul
EUR 397
Anti-Sall4 Antibody
A1692-100
EUR 479
anti- SALL4 antibody
FNab07583 100µg
EUR 585
  • Immunogen: sal-like 4(Drosophila)
  • Uniprot ID: Q9UJQ4
  • Gene ID: 57167
  • Research Area: Metabolism, Immunology, Cancer, Developmental biology, Stem Cells
Description: Antibody raised against SALL4
anti- SALL4 antibody
FNab07584 100µg
EUR 585
  • Recommended dilution: WB: 1:500 - 1:2000
  • Immunogen: sal-like 4(Drosophila)
  • Uniprot ID: Q9UJQ4
  • Gene ID: 57167
  • Research Area: Metabolism, Immunology, Cancer, Developmental biology, Stem Cells
Description: Antibody raised against SALL4
Anti-SALL4 antibody
PAab07583 100 ug
EUR 412
Anti-SALL4 antibody
STJ111252 100 µl
EUR 277
Description: This gene encodes a zinc finger transcription factor thought to play a role in the development of abducens motor neurons. Defects in this gene are a cause of Duane-radial ray syndrome (DRRS). Alternative splicing results in multiple transcript variants encoding different isoforms.
Anti-SALL4 antibody
STJ118646 100 µl
EUR 277
Anti-SALL4 antibody
STJ160131 1 mL C
EUR 544
Anti-SALL4 antibody
STJ29204 100 µl
EUR 277
Description: This gene encodes a zinc finger transcription factor thought to play a role in the development of abducens motor neurons. Defects in this gene are a cause of Duane-radial ray syndrome (DRRS). Alternative splicing results in multiple transcript variants encoding different isoforms.
Anti-SALL4 antibody
STJ192552 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SALL4
Anti-SALL4 antibody
STJ180237 0.1 ml
EUR 244
SALL4 siRNA
20-abx932410
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SALL4 siRNA
20-abx932411
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-SALL4
YF-PA26465 50 ul
EUR 334
Description: Mouse polyclonal to SALL4
Anti-Sall4 (mouse) antibody
STJ71177 100 µg
EUR 359
SALL4 cloning plasmid
CSB-CL892126HU-10ug 10ug
EUR 1164
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3162
  • Sequence: ATGTCGAGGCGCAAGCAGGCGAAACCCCAGCACATCAACTCGGAGGAGGACCAGGGCGAGCAGCAGCCGCAGCAGCAGACCCCGGAGTTTGCAGATGCGGCCCCAGCGGCGCCCGCGGCGGGGGAGCTGGGTGCTCCAGTGAACCACCCAGGGAATGACGAGGTGGCGAGTGAGG
  • Show more
Description: A cloning plasmid for the SALL4 gene.
Sall4 Blocking Peptide
DF7757-BP 1mg
EUR 195
Anti-SALL4 (6E3)
YF-MA11603 100 ug
EUR 363
Description: Mouse monoclonal to SALL4
Monoclonal SALL4 Antibody, Clone: 1E11A4
AMM03062G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human SALL4. The antibodies are raised in Mouse and are from clone 1E11A4. This antibody is applicable in WB and IHC, FC, ICC, E
SALL4 ELISA KIT|Human
EF002699 96 Tests
EUR 689
Human SALL4 shRNA Plasmid
20-abx961370
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse SALL4 shRNA Plasmid
20-abx979406
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Sal-Like Protein 4 (SALL4) Antibody
20-abx005379
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Sal-Like Protein 4 (SALL4) Antibody
20-abx218433
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Sal-Like Protein 4 (SALL4) Antibody
abx224198-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.
Sal-Like Protein 4 (SALL4) Antibody
20-abx127041
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
Sal-Like Protein 4 (SALL4) Antibody
abx028391-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Sal-Like Protein 4 (SALL4) Antibody
abx028391-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Sal-Like Protein 4 (SALL4) Antibody
abx237583-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.
Sal-Like Protein 4 (SALL4) Antibody
abx237584-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.
Sal-Like Protein 4 (SALL4) Antibody
20-abx320299
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Sal-Like Protein 4 (SALL4) Antibody
abx432248-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
SALL4 (Sal-Like Protein 4)
MO47050 100 ug
EUR 349
SALL4 ORF Vector (Human) (pORF)
ORF014359 1.0 ug DNA
EUR 354
Sall4 ORF Vector (Mouse) (pORF)
ORF056637 1.0 ug DNA
EUR 506
Sall4 ORF Vector (Mouse) (pORF)
ORF056638 1.0 ug DNA
EUR 506
Sall4 ORF Vector (Mouse) (pORF)
ORF056639 1.0 ug DNA
EUR 506
pECMV-Sall4-m-FLAG Plasmid
PVT15326 2 ug
EUR 325
pECMV-Sall4-m-FLAG Plasmid
PVT15756 2 ug
EUR 325
SALL4 ELISA Kit (Human) (OKCA00803)
OKCA00803 96 Wells
EUR 833
Description: Description of target: Transcription factor with a key role in the maintenance and self-renewal of embryonic and hematopoietic stem cells.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 9.37 pg/mL
Mouse Anti-Human SALL4 monoclonal antibody, clone JID770
CABT-L2858-100uL500uL 100 uL, 500 uL
EUR 502
Sall4 sgRNA CRISPR Lentivector set (Mouse)
K3781801 3 x 1.0 ug
EUR 339
SALL4 sgRNA CRISPR Lentivector set (Human)
K2086501 3 x 1.0 ug
EUR 339
Human Sal Like Protein 4 (SALL4) Protein
20-abx654986
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Sall4 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3781802 1.0 ug DNA
EUR 154
Sall4 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3781803 1.0 ug DNA
EUR 154
Sall4 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3781804 1.0 ug DNA
EUR 154
SALL4 sgRNA CRISPR Lentivector (Human) (Target 1)
K2086502 1.0 ug DNA
EUR 154
SALL4 sgRNA CRISPR Lentivector (Human) (Target 2)
K2086503 1.0 ug DNA
EUR 154
SALL4 sgRNA CRISPR Lentivector (Human) (Target 3)
K2086504 1.0 ug DNA
EUR 154
SALL4 Protein Vector (Human) (pPB-C-His)
PV057433 500 ng
EUR 329
SALL4 Protein Vector (Human) (pPB-N-His)
PV057434 500 ng
EUR 481
SALL4 Protein Vector (Human) (pPM-C-HA)
PV057435 500 ng
EUR 481
SALL4 Protein Vector (Human) (pPM-C-His)
PV057436 500 ng
EUR 481
SALL4 Protein Vector (Mouse) (pPB-C-His)
PV226546 500 ng
EUR 603
SALL4 Protein Vector (Mouse) (pPB-N-His)
PV226547 500 ng
EUR 603
SALL4 Protein Vector (Mouse) (pPM-C-HA)
PV226548 500 ng
EUR 603
SALL4 Protein Vector (Mouse) (pPM-C-His)
PV226549 500 ng
EUR 603
SALL4 Protein Vector (Mouse) (pPB-C-His)
PV226550 500 ng
EUR 1065
SALL4 Protein Vector (Mouse) (pPB-N-His)
PV226551 500 ng
EUR 1065
SALL4 Protein Vector (Mouse) (pPM-C-HA)
PV226552 500 ng
EUR 1065
SALL4 Protein Vector (Mouse) (pPM-C-His)
PV226553 500 ng
EUR 1065
SALL4 Protein Vector (Mouse) (pPB-C-His)
PV226554 500 ng
EUR 603
SALL4 Protein Vector (Mouse) (pPB-N-His)
PV226555 500 ng
EUR 603
SALL4 Protein Vector (Mouse) (pPM-C-HA)
PV226556 500 ng
EUR 603
SALL4 Protein Vector (Mouse) (pPM-C-His)
PV226557 500 ng
EUR 603
Sall4 3'UTR Luciferase Stable Cell Line
TU118323 1.0 ml Ask for price
Sall4 3'UTR GFP Stable Cell Line
TU168323 1.0 ml Ask for price
SALL4 3'UTR GFP Stable Cell Line
TU072564 1.0 ml
EUR 1394
SALL4 3'UTR Luciferase Stable Cell Line
TU022564 1.0 ml
EUR 1394

SALL4 Rabbit Polyclonal Antibody

Recent Posts

Categories

January 2022
M T W T F S S
 12
3456789
10111213141516
17181920212223
24252627282930
31  

Pages