Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG

fallback-image

NIPA1 Rabbit Polyclonal Antibody

NIPA1 Rabbit Polyclonal Antibody

Contact us: [email protected]

NIPA1 Polyclonal Antibody

ABP59468-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human NIPA1 protein at amino acid sequence of 111-160
  • Applications tips:
Description: A polyclonal antibody for detection of NIPA1 from Human, Mouse. This NIPA1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NIPA1 protein at amino acid sequence of 111-160

NIPA1 Polyclonal Antibody

ES11442-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NIPA1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

NIPA1 Polyclonal Antibody

ES11442-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NIPA1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

NIPA1 Antibody

43886-100ul 100ul
EUR 252

NIPA1 Conjugated Antibody

C43886 100ul
EUR 397

Anti-NIPA1 antibody

STJ192600 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NIPA1

NIPA1 siRNA

20-abx925917
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NIPA1 siRNA

20-abx925918
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Mouse Magnesium transporter NIPA1, Nipa1 ELISA KIT

ELI-15093m 96 Tests
EUR 865

Human Magnesium transporter NIPA1, NIPA1 ELISA KIT

ELI-44030h 96 Tests
EUR 824

NIPA1 cloning plasmid

CSB-CL742399HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 765
  • Sequence: atggctgttggccagattggaaacttcctggcttacacggcggtccccacggtcctggtaacccccctgggcgcccttggagtaccgttcgggtccattttagcttcctatctcctgaaggaaaagctcaacatcttgggcaagttggggtgcctgctaagctgtgcaggctccgt
  • Show more
Description: A cloning plasmid for the NIPA1 gene.

Human NIPA1 shRNA Plasmid

20-abx964733
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse NIPA1 shRNA Plasmid

20-abx982047
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pCMV-SPORT6-NIPA1 Plasmid

PVT16286 2 ug
EUR 325

NIPA1 Recombinant Protein (Human)

RP021247 100 ug Ask for price

NIPA1 Recombinant Protein (Mouse)

RP154127 100 ug Ask for price

NIPA1 Recombinant Protein (Rat)

RP213947 100 ug Ask for price

Nipa1 ORF Vector (Rat) (pORF)

ORF071317 1.0 ug DNA
EUR 506

NIPA1 ORF Vector (Human) (pORF)

ORF007083 1.0 ug DNA
EUR 95

Nipa1 ORF Vector (Mouse) (pORF)

ORF051377 1.0 ug DNA
EUR 506

NIPA1 Rabbit Polyclonal Antibody

Recent Posts

Categories

January 2022
M T W T F S S
 12
3456789
10111213141516
17181920212223
24252627282930
31  

Pages