Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG


TSHB Rabbit Polyclonal Antibody

TSHB Rabbit Polyclonal Antibody

Contact us: [email protected]

TSHB Polyclonal Antibody

ES11163-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TSHB from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

TSHB Polyclonal Antibody

ES11163-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TSHB from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

TSHB Rabbit pAb

A14523-100ul 100 ul
EUR 308

TSHB Rabbit pAb

A14523-200ul 200 ul
EUR 459

TSHB Rabbit pAb

A14523-20ul 20 ul
EUR 183

TSHB Rabbit pAb

A14523-50ul 50 ul
EUR 223

TSHB Rabbit pAb

A6780-100ul 100 ul
EUR 308

TSHB Rabbit pAb

A6780-200ul 200 ul
EUR 459

TSHB Rabbit pAb

A6780-20ul 20 ul
EUR 183

TSHB Rabbit pAb

A6780-50ul 50 ul
EUR 223

Polyclonal TSHB Antibody (Center)

APR10580G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TSHB (Center). This antibody is tested and proven to work in the following applications:

TSHB Polyclonal Antibody, HRP Conjugated

A50685 100 µg
EUR 570.55
Description: The best epigenetics products

TSHB Polyclonal Antibody, FITC Conjugated

A50686 100 µg
EUR 570.55
Description: kits suitable for this type of research

TSHB Polyclonal Antibody, Biotin Conjugated

A50687 100 µg
EUR 570.55
Description: fast delivery possible

TSHB antibody

39176-100ul 100ul
EUR 252

TSHB Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TSHB. Recognizes TSHB from Human. This antibody is Unconjugated. Tested in the following application: ELISA

TSHB Conjugated Antibody

C39176 100ul
EUR 397

Anti-TSHB antibody

STJ28863 100 µl
EUR 277
Description: The four human glycoprotein hormones chorionic gonadotropin (CG), luteinizing hormone (LH), follicle stimulating hormone (FSH), and thyroid stimulating hormone (TSH) are dimers consisting of alpha and beta subunits that are associated noncovalently. The alpha subunits of these hormones are identical, however, their beta chains are unique and confer biological specificity. Thyroid stimulating hormone functions in the control of thyroid structure and metabolism. The protein encoded by this gene is the beta subunit of thyroid stimulating hormone. Mutations in this gene are associated with congenital central and secondary hypothyroidism and Hashimoto's thyroiditis. Alternative splicing of this gene results in multiple transcript variants.

Anti-TSHB antibody

STJ116734 100 µl
EUR 277
Description: The four human glycoprotein hormones chorionic gonadotropin (CG), luteinizing hormone (LH), follicle stimulating hormone (FSH), and thyroid stimulating hormone (TSH) are dimers consisting of alpha and beta subunits that are associated noncovalently. The alpha subunits of these hormones are identical, however, their beta chains are unique and confer biological specificity. Thyroid stimulating hormone functions in the control of thyroid structure and metabolism. The protein encoded by this gene is the beta subunit of thyroid stimulating hormone. Mutations in this gene are associated with congenital central and secondary hypothyroidism and Hashimoto's thyroiditis. Alternative splicing of this gene results in multiple transcript variants.

Anti-TSHB antibody

STJ400191 1 mg
EUR 446
Description: Thyroid-stimulating hormone (also known as TSH or thyrotropin) is a peptide hormone synthesized and secreted by thyrotrope cells in the anterior pituitary gland which regulates the endocrine function of the thyroid gland. TSH levels are tested in the blood of patients suspected of suffering from excess (hyperthyroidism), or deficiency (hypothyroidism) of thyroid hormone.

Anti-TSHB antibody

STJ400193 1 mg
EUR 446
Description: Thyroid-stimulating hormone (also known as TSH or thyrotropin) is a peptide hormone synthesized and secreted by thyrotrope cells in the anterior pituitary gland which regulates the endocrine function of the thyroid gland. TSH levels are tested in the blood of patients suspected of suffering from excess (hyperthyroidism), or deficiency (hypothyroidism) of thyroid hormone.

Anti-TSHB antibody

STJ400194 1 mg
EUR 446
Description: Thyroid-stimulating hormone (also known as TSH or thyrotropin) is a peptide hormone synthesized and secreted by thyrotrope cells in the anterior pituitary gland which regulates the endocrine function of the thyroid gland. TSH levels are tested in the blood of patients suspected of suffering from excess (hyperthyroidism), or deficiency (hypothyroidism) of thyroid hormone.

Anti-TSHB antibody

STJ400195 1 mg
EUR 446
Description: Thyroid-stimulating hormone (also known as TSH or thyrotropin) is a peptide hormone synthesized and secreted by thyrotrope cells in the anterior pituitary gland which regulates the endocrine function of the thyroid gland. TSH levels are tested in the blood of patients suspected of suffering from excess (hyperthyroidism), or deficiency (hypothyroidism) of thyroid hormone.

Anti-TSHB antibody

STJ400196 1 mg
EUR 446
Description: Thyroid-stimulating hormone (also known as TSH or thyrotropin) is a peptide hormone synthesized and secreted by thyrotrope cells in the anterior pituitary gland which regulates the endocrine function of the thyroid gland. TSH levels are tested in the blood of patients suspected of suffering from excess (hyperthyroidism), or deficiency (hypothyroidism) of thyroid hormone.

Anti-TSHB antibody

STJ400197 1 mg
EUR 424
Description: Thyroid-stimulating hormone (also known as TSH or thyrotropin) is a peptide hormone synthesized and secreted by thyrotrope cells in the anterior pituitary gland which regulates the endocrine function of the thyroid gland. TSH levels are tested in the blood of patients suspected of suffering from excess (hyperthyroidism), or deficiency (hypothyroidism) of thyroid hormone.

Anti-TSHB antibody

STJ192321 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to TSHB

Anti-TSHB Antibody

STJ503423 100 µg
EUR 476

Anti-TSHB Antibody

STJ503424 100 µg
EUR 476


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TSHB Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TSHB. Recognizes TSHB from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TSHB Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TSHB. Recognizes TSHB from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TSHB Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TSHB. Recognizes TSHB from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-TSHB Antibody (Biotin)

STJ503425 100 µg
EUR 586

Anti-TSHB Antibody (FITC)

STJ503426 100 µg
EUR 586

Anti-TSHB Antibody (Biotin)

STJ503427 100 µg
EUR 586

Anti-TSHB Antibody (FITC)

STJ503428 100 µg
EUR 586

Thyroid Stimulating Hormone Beta (TSHb) Polyclonal Antibody (Dog)

  • EUR 268.00
  • EUR 2840.00
  • EUR 700.00
  • EUR 340.00
  • EUR 223.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TSHb (Ser20~Ile138)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Dog Thyroid Stimulating Hormone Beta (TSHb)

Thyroid Stimulating Hormone Beta (TSHb) Polyclonal Antibody (Mouse)

  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TSHb (Phe21~Val138)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Thyroid Stimulating Hormone Beta (TSHb)

Rabbit Thyrotropin subunit β(TSHB) ELISA kit

E04T0738-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Thyrotropin subunit β(TSHB) ELISA kit

E04T0738-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Thyrotropin subunit β(TSHB) ELISA kit

E04T0738-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

TSHB cloning plasmid

CSB-CL025130HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 417
  • Sequence: atgactgctctctttctgatgtccatgctttttggccttgcatgtgggcaagcgatgtctttttgtattccaactgagtatacaatgcacatcgaaaggagagagtgtgcttattgcctaaccatcaacaccaccatctgtgctggatattgtatgacacgggatatcaatggcaa
  • Show more
Description: A cloning plasmid for the TSHB gene.

Recombinant Rat Tshb

P2468 100ug Ask for price
  • Uniprot ID: P04652
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for Rat Tshb

Monoclonal TSHB Antibody, Clone: 1D12G1

APR10579G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human TSHB. The antibodies are raised in Mouse and are from clone 1D12G1. This antibody is applicable in WB and IHC, FC, ICC, E

Thyrotropin Subunit Beta (TSHB) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Thyrotropin Subunit Beta (TSHB) Antibody

abx224242-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

Thyrotropin Subunit Beta (TSHb) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Thyrotropin Subunit Beta (TSHB) Antibody

abx034029-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Thyrotropin Subunit Beta (TSHB) Antibody

abx034029-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Thyrotropin Subunit Beta (TSHB) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Thyroid Stimulating Hormone Beta (TSHb) Polyclonal Antibody (Dog), APC

  • EUR 377.00
  • EUR 3725.00
  • EUR 1025.00
  • EUR 485.00
  • EUR 233.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TSHb (Ser20~Ile138)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Dog Thyroid Stimulating Hormone Beta (TSHb). This antibody is labeled with APC.

Thyroid Stimulating Hormone Beta (TSHb) Polyclonal Antibody (Dog), Biotinylated

  • EUR 334.00
  • EUR 2790.00
  • EUR 810.00
  • EUR 414.00
  • EUR 229.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TSHb (Ser20~Ile138)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Dog Thyroid Stimulating Hormone Beta (TSHb). This antibody is labeled with Biotin.

Thyroid Stimulating Hormone Beta (TSHb) Polyclonal Antibody (Dog), Cy3

  • EUR 461.00
  • EUR 4925.00
  • EUR 1325.00
  • EUR 605.00
  • EUR 269.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TSHb (Ser20~Ile138)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Dog Thyroid Stimulating Hormone Beta (TSHb). This antibody is labeled with Cy3.

Thyroid Stimulating Hormone Beta (TSHb) Polyclonal Antibody (Dog), FITC

  • EUR 321.00
  • EUR 3000.00
  • EUR 840.00
  • EUR 408.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TSHb (Ser20~Ile138)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Dog Thyroid Stimulating Hormone Beta (TSHb). This antibody is labeled with FITC.

Thyroid Stimulating Hormone Beta (TSHb) Polyclonal Antibody (Dog), HRP

  • EUR 343.00
  • EUR 3245.00
  • EUR 905.00
  • EUR 437.00
  • EUR 218.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TSHb (Ser20~Ile138)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Dog Thyroid Stimulating Hormone Beta (TSHb). This antibody is labeled with HRP.

Thyroid Stimulating Hormone Beta (TSHb) Polyclonal Antibody (Dog), PE

  • EUR 321.00
  • EUR 3000.00
  • EUR 840.00
  • EUR 408.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TSHb (Ser20~Ile138)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Dog Thyroid Stimulating Hormone Beta (TSHb). This antibody is labeled with PE.

Thyroid Stimulating Hormone Beta (TSHb) Polyclonal Antibody (Mouse), APC

  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TSHb (Phe21~Val138)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Thyroid Stimulating Hormone Beta (TSHb). This antibody is labeled with APC.

Thyroid Stimulating Hormone Beta (TSHb) Polyclonal Antibody (Mouse), Biotinylated

  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TSHb (Phe21~Val138)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Thyroid Stimulating Hormone Beta (TSHb). This antibody is labeled with Biotin.

Thyroid Stimulating Hormone Beta (TSHb) Polyclonal Antibody (Mouse), Cy3

  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TSHb (Phe21~Val138)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Thyroid Stimulating Hormone Beta (TSHb). This antibody is labeled with Cy3.

Thyroid Stimulating Hormone Beta (TSHb) Polyclonal Antibody (Mouse), FITC

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TSHb (Phe21~Val138)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Thyroid Stimulating Hormone Beta (TSHb). This antibody is labeled with FITC.

Thyroid Stimulating Hormone Beta (TSHb) Polyclonal Antibody (Mouse), HRP

  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TSHb (Phe21~Val138)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Thyroid Stimulating Hormone Beta (TSHb). This antibody is labeled with HRP.

Thyroid Stimulating Hormone Beta (TSHb) Polyclonal Antibody (Mouse), PE

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TSHb (Phe21~Val138)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Thyroid Stimulating Hormone Beta (TSHb). This antibody is labeled with PE.

Thyroid Stimulating Hormone Beta (TSHb) Polyclonal Antibody (Dog), APC-Cy7

  • EUR 634.00
  • EUR 7330.00
  • EUR 1930.00
  • EUR 850.00
  • EUR 346.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TSHb (Ser20~Ile138)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Dog Thyroid Stimulating Hormone Beta (TSHb). This antibody is labeled with APC-Cy7.

Thyroid Stimulating Hormone Beta (TSHb) Polyclonal Antibody (Mouse), APC-Cy7

  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TSHb (Phe21~Val138)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Thyroid Stimulating Hormone Beta (TSHb). This antibody is labeled with APC-Cy7.

Thyroid Stimulating Hormone Beta (TSHb) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Thyroid Stimulating Hormone Beta (TSHb) Antibody

  • EUR 328.00
  • EUR 133.00
  • EUR 913.00
  • EUR 467.00
  • EUR 286.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Thyroid Stimulating Hormone Beta (TSHb) Antibody

  • EUR 342.00
  • EUR 871.00
  • EUR 453.00
  • EUR 154.00
  • EUR 272.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

Thyroid Stimulating Hormone Beta (TSHb) Antibody

abx239835-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Thyrotropin Subunit Beta (TSHB) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Thyrotropin Subunit Beta (TSHB) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Thyrotropin Subunit Beta (TSHB) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

TSHB protein (His tag)

80R-3560 20 ug
EUR 327
Description: Purified recombinant TSHB protein (His tag)


ELA-E0463h 96 Tests
EUR 824


EF000321 96 Tests
EUR 689

Rat TSHB shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human TSHB shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TSHB Human Recombinant Protein

PROTP01222 Regular: 10ug
EUR 317
Description: TSHB Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 141 amino acids (21-138 a.a) and having a molecular mass of 15.9kDa.

TSHB Recombinant Protein (Rat)

RP234968 100 ug Ask for price

TSHB Recombinant Protein (Human)

RP033139 100 ug Ask for price

TSHB Recombinant Protein (Mouse)

RP181703 100 ug Ask for price

TSHB Recombinant Protein (Mouse)

RP181706 100 ug Ask for price

TSHB Recombinant Protein (Mouse)

RP181709 100 ug Ask for price


STJ150033 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of TSH in Mouse serum, plasma and other biological fluids

TSHB Rabbit Polyclonal Antibody

Recent Posts


January 2022
