Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG

fallback-image

LAX1 Rabbit Polyclonal Antibody

LAX1 Rabbit Polyclonal Antibody

Contact us: [email protected]

LAX1 Polyclonal Antibody

ABP59097-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human LAX1 protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of LAX1 from Human, Mouse, Rat. This LAX1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LAX1 protein at amino acid sequence of 30-110

LAX1 Polyclonal Antibody

ES11285-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against LAX1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

LAX1 Polyclonal Antibody

ES11285-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against LAX1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

LAX1 Rabbit pAb

A12218-100ul 100 ul
EUR 308

LAX1 Rabbit pAb

A12218-200ul 200 ul
EUR 459

LAX1 Rabbit pAb

A12218-20ul 20 ul
EUR 183

LAX1 Rabbit pAb

A12218-50ul 50 ul
EUR 223

LAX1 Polyclonal Conjugated Antibody

C27649 100ul
EUR 397

LAX1 antibody

70R-18223 50 ul
EUR 435
Description: Rabbit polyclonal LAX1 antibody

LAX1 Antibody

1-CSB-PA811614LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LAX1. Recognizes LAX1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200

LAX1 antibody

70R-6590 50 ug
EUR 467
Description: Rabbit polyclonal LAX1 antibody raised against the middle region of LAX1

LAX1 antibody

70R-9683 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal LAX1 antibody

LAX1 Antibody

1-CSB-PA012771GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against LAX1. Recognizes LAX1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Polyclonal LAX1 Antibody (internal region)

APR17176G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human LAX1 (internal region). This antibody is tested and proven to work in the following applications:

Lax1/ Rat Lax1 ELISA Kit

ELI-14389r 96 Tests
EUR 886

anti- LAX1 antibody

FNab04710 100µg
EUR 505.25
  • Immunogen: lymphocyte transmembrane adaptor 1
  • Uniprot ID: Q8IWV1
  • Gene ID: 54900
  • Research Area: Signal Transduction
Description: Antibody raised against LAX1

Anti-LAX1 antibody

PAab04710 100 ug
EUR 355

Anti-LAX1 antibody

STJ114109 100 µl
EUR 277

Anti-LAX1 antibody

STJ72071 100 µg
EUR 260

Anti-LAX1 antibody

STJ192443 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to LAX1

LAX1 siRNA

20-abx902939
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LAX1 siRNA

20-abx922300
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LAX1 siRNA

20-abx922301
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-LAX1

YF-PA19440 50 ug
EUR 363
Description: Mouse polyclonal to LAX1

LAX1 Antibody, HRP conjugated

1-CSB-PA811614LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LAX1. Recognizes LAX1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

LAX1 Antibody, FITC conjugated

1-CSB-PA811614LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LAX1. Recognizes LAX1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

LAX1 Antibody, Biotin conjugated

1-CSB-PA811614LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LAX1. Recognizes LAX1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

LAX1 Blocking Peptide

33R-4955 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of LAX1 antibody, catalog no. 70R-6590

LAX1 Blocking Peptide

33R-1089 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KCTD11 antibody, catalog no. 70R-1493

LAX1 cloning plasmid

CSB-CL811614HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 969
  • Sequence: atgcccttgctgactttgccacaaaccagacaaagagccaaaaatatttatgacatcttgccttggcgacaggaagacctggggagacatgagtcgaggagtatgcgcattttcagtactgagagcctcctctccagaaattctgagagcccggagcatgtgccctcccaagcagg
  • Show more
Description: A cloning plasmid for the LAX1 gene.

LAX1 ELISA KIT|Human

EF010631 96 Tests
EUR 689

Rat LAX1 shRNA Plasmid

20-abx990851
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human LAX1 shRNA Plasmid

20-abx960308
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse LAX1 shRNA Plasmid

20-abx982472
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

LAX1 Recombinant Protein (Human)

RP017578 100 ug Ask for price

LAX1 Rabbit Polyclonal Antibody

Recent Posts

Categories

January 2022
M T W T F S S
 12
3456789
10111213141516
17181920212223
24252627282930
31  

Pages