Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG

fallback-image

FLRT2 Rabbit Polyclonal Antibody

FLRT2 Rabbit Polyclonal Antibody

Contact us: [email protected]

FLRT2 Polyclonal Antibody

ABP58572-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human FLRT2 protein at amino acid sequence of 170-250
  • Applications tips:
Description: A polyclonal antibody for detection of FLRT2 from Human. This FLRT2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FLRT2 protein at amino acid sequence of 170-250

FLRT2 Polyclonal Antibody

ABP58572-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human FLRT2 protein at amino acid sequence of 170-250
  • Applications tips:
Description: A polyclonal antibody for detection of FLRT2 from Human. This FLRT2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FLRT2 protein at amino acid sequence of 170-250

FLRT2 Polyclonal Antibody

ABP58572-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human FLRT2 protein at amino acid sequence of 170-250
  • Applications tips:
Description: A polyclonal antibody for detection of FLRT2 from Human. This FLRT2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FLRT2 protein at amino acid sequence of 170-250

FLRT2 Polyclonal Antibody

ES11281-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against FLRT2 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

FLRT2 Polyclonal Antibody

ES11281-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against FLRT2 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

FLRT2 Rabbit pAb

A17668-100ul 100 ul
EUR 308

FLRT2 Rabbit pAb

A17668-200ul 200 ul
EUR 459

FLRT2 Rabbit pAb

A17668-20ul 20 ul
EUR 183

FLRT2 Rabbit pAb

A17668-50ul 50 ul
EUR 223

FLRT2 Polyclonal Conjugated Antibody

C30115 100ul
EUR 397

Rabbit FLRT2 ELISA Kit

ERTF0109 96Tests
EUR 521

Anti-FLRT2 antibody

STJ119717 100 µl
EUR 277
Description: This gene encodes a member of the fibronectin leucine rich transmembrane (FLRT) family of cell adhesion molecules, which regulate early embryonic vascular and neural development. The encoded type I transmembrane protein has an extracellular region consisting of an N-terminal leucine-rich repeat domain and a type 3 fibronectin domain, followed by a transmembrane domain and a short C-terminal cytoplasmic tail domain. It functions as both a homophilic cell adhesion molecule and a heterophilic chemorepellent through its interaction with members of the uncoordinated-5 receptor family. Proteolytic removal of the extracellular region controls the migration of neurons in the developing cortex. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]

Anti-FLRT2 antibody

STJ192439 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to FLRT2

FLRT2 siRNA

20-abx916977
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FLRT2 cloning plasmid

CSB-CL008730HU-10ug 10ug
EUR 665
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1983
  • Sequence: atgggcctacagaccacaaagtggcccagccatggggcttttttcctgaagtcttggcttatcatttccctggggctctactcacaggtgtccaaactcctggcctgccctagtgtgtgccgctgcgacaggaactttgtctactgtaatgagcgaagcttgacctcagtgcctc
  • Show more
Description: A cloning plasmid for the FLRT2 gene.

Human FLRT2 ELISA Kit

EHF0109 96Tests
EUR 521

Goat FLRT2 ELISA Kit

EGTF0109 96Tests
EUR 521

Bovine FLRT2 ELISA Kit

EBF0109 96Tests
EUR 521

Canine FLRT2 ELISA Kit

ECF0109 96Tests
EUR 521

Anserini FLRT2 ELISA Kit

EAF0109 96Tests
EUR 521

Human FLRT2 ELISA KIT

ELI-09849h 96 Tests
EUR 824

Human FLRT2 shRNA Plasmid

20-abx958456
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse FLRT2 ELISA Kit

EMF0109 96Tests
EUR 521

Rat FLRT2 ELISA Kit

ERF0109 96Tests
EUR 521

Porcine FLRT2 ELISA Kit

EPF0109 96Tests
EUR 521

FLRT2 Recombinant Protein (Human)

RP039232 100 ug Ask for price

FLRT2 Recombinant Protein (Rat)

RP201539 100 ug Ask for price

FLRT2 Recombinant Protein (Mouse)

RP134801 100 ug Ask for price

Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2) Polyclonal Antibody (Human)

4-PAC481Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FLRT2 (Ser300~Ser517)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2)

Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2) Polyclonal Antibody (Human), APC

4-PAC481Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FLRT2 (Ser300~Ser517)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2). This antibody is labeled with APC.

Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2) Polyclonal Antibody (Human), Biotinylated

4-PAC481Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FLRT2 (Ser300~Ser517)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2). This antibody is labeled with Biotin.

FLRT2 Rabbit Polyclonal Antibody

Recent Posts

Categories

January 2022
M T W T F S S
 12
3456789
10111213141516
17181920212223
24252627282930
31  

Pages