FGGY Rabbit Polyclonal Antibody

Contact us: [email protected]

FGGY Polyclonal Antibody
ABP58552-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human FGGY protein at amino acid sequence of 491-540 Applications tips:
Description: A polyclonal antibody for detection of FGGY from Human. This FGGY antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FGGY protein at amino acid sequence of 491-540

FGGY Polyclonal Antibody
ES11426-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against FGGY from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

FGGY Polyclonal Antibody
ES11426-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against FGGY from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

FGGY Rabbit pAb
A14904-100ul	Abclonal	100 ul	EUR 308

FGGY Rabbit pAb
A14904-200ul	Abclonal	200 ul	EUR 459

FGGY Rabbit pAb
A14904-20ul	Abclonal	20 ul	EUR 183

FGGY Rabbit pAb
A14904-50ul	Abclonal	50 ul	EUR 223

FGGY Polyclonal Conjugated Antibody
C28752	SAB	100ul	EUR 397

Fggy antibody
70R-8778	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal Fggy antibody

Polyclonal Fggy antibody - N-terminal region
APR11909G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Fggy - N-terminal region. This antibody is tested and proven to work in the following applications:

Anti-FGGY antibody
STJ117104	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a protein that phosphorylates carbohydrates such as ribulose, ribitol, and L-arabinitol. Genome-wide association studies in some populations have found an association between polymorphisms in this gene and sporadic amyotrophic lateral sclerosis, but studies of other populations have not been able to replicate this association. Alternative splicing results in multiple transcript variants.

Anti-FGGY antibody
STJ192584	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to FGGY

FGGY siRNA
20-abx916860	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

FGGY siRNA
20-abx916861	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

pOTB7-FGGY
PVT18905	Lifescience Market	2 ug	EUR 231

Fggy Blocking Peptide
33R-6678	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Fggy antibody, catalog no. 70R-8778

FGGY cloning plasmid
CSB-CL853393HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1320 Sequence: atgtggctggaccatcgagcagtcagtcaagttaacaggatcaatgagaccaagcacagtgtcctccagtacgtcgggggggtgatgtctgtggaaatgcaggccccgaaacttctgtggctgaaagagaacttgagagagatttgctgggataaggcgggacatttctttgatc Show more
Description: A cloning plasmid for the FGGY gene.

FGGY cloning plasmid
CSB-CL853393HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 759 Sequence: atggggatcagcaaagacccgatttttgtaccaggcgtctgggggccttatttctcagccatggtacctgggttctggctgaatgaaggtggtcagagcgttactggaaaattgatagaccacatggtacaaggccatgctgcttttccagaactacaagtaaaggccacagccag Show more
Description: A cloning plasmid for the FGGY gene.

Human FGGY Carbohydrate Kinase Domain Containing (FGGY) ELISA Kit
abx384900-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse FGGY Carbohydrate Kinase Domain Containing (FGGY) ELISA Kit
abx389281-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Fggy ELISA KIT
ELI-26682m	Lifescience Market	96 Tests	EUR 865

FGGY ELISA KIT|Human
EF004978	Lifescience Market	96 Tests	EUR 689

Mouse FGGY shRNA Plasmid
20-abx978434	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human FGGY shRNA Plasmid
20-abx960616	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human FGGY ELISA KIT
ELI-47438h	Lifescience Market	96 Tests	EUR 824

FGGY Recombinant Protein (Human)
RP012145	ABM	100 ug	Ask for price

FGGY Recombinant Protein (Human)
RP012148	ABM	100 ug	Ask for price

FGGY Recombinant Protein (Rat)
RP201371	ABM	100 ug	Ask for price

FGGY Recombinant Protein (Mouse)
RP134561	ABM	100 ug	Ask for price

FGGY Recombinant Protein (Mouse)
RP134564	ABM	100 ug	Ask for price

Fggy ORF Vector (Rat) (pORF)
ORF067125	ABM	1.0 ug DNA	EUR 506

FGGY ORF Vector (Human) (pORF)
ORF004049	ABM	1.0 ug DNA	EUR 95

FGGY ORF Vector (Human) (pORF)
ORF004050	ABM	1.0 ug DNA	EUR 95

Fggy ORF Vector (Mouse) (pORF)
ORF044855	ABM	1.0 ug DNA	EUR 506

Fggy ORF Vector (Mouse) (pORF)
ORF044856	ABM	1.0 ug DNA	EUR 506

Fggy sgRNA CRISPR Lentivector set (Rat)
K7423001	ABM	3 x 1.0 ug	EUR 339

FGGY sgRNA CRISPR Lentivector set (Human)
K0780701	ABM	3 x 1.0 ug	EUR 339

Fggy sgRNA CRISPR Lentivector set (Mouse)
K4105601	ABM	3 x 1.0 ug	EUR 339

anti-FGGY carbohydrate kinase domain containing
YF-PA19661	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to FGGY carbohydrate kinase domain containing

anti-FGGY carbohydrate kinase domain containing
YF-PA19662	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to FGGY carbohydrate kinase domain containing

anti-FGGY carbohydrate kinase domain containing
YF-PA19663	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to FGGY carbohydrate kinase domain containing

anti-FGGY carbohydrate kinase domain containing
YF-PA26319	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to FGGY carbohydrate kinase domain containing

Fggy sgRNA CRISPR Lentivector (Rat) (Target 1)
K7423002	ABM	1.0 ug DNA	EUR 154

Fggy sgRNA CRISPR Lentivector (Rat) (Target 2)
K7423003	ABM	1.0 ug DNA	EUR 154

Fggy sgRNA CRISPR Lentivector (Rat) (Target 3)
K7423004	ABM	1.0 ug DNA	EUR 154

FGGY sgRNA CRISPR Lentivector (Human) (Target 1)
K0780702	ABM	1.0 ug DNA	EUR 154

FGGY sgRNA CRISPR Lentivector (Human) (Target 2)
K0780703	ABM	1.0 ug DNA	EUR 154

FGGY sgRNA CRISPR Lentivector (Human) (Target 3)
K0780704	ABM	1.0 ug DNA	EUR 154

Fggy sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4105602	ABM	1.0 ug DNA	EUR 154

Fggy sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4105603	ABM	1.0 ug DNA	EUR 154

Fggy sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4105604	ABM	1.0 ug DNA	EUR 154

FGGY Protein Vector (Mouse) (pPB-C-His)
PV179418	ABM	500 ng	EUR 603

FGGY Protein Vector (Mouse) (pPB-N-His)
PV179419	ABM	500 ng	EUR 603

FGGY Protein Vector (Mouse) (pPM-C-HA)
PV179420	ABM	500 ng	EUR 603

FGGY Protein Vector (Mouse) (pPM-C-His)
PV179421	ABM	500 ng	EUR 603

FGGY Protein Vector (Mouse) (pPB-C-His)
PV179422	ABM	500 ng	EUR 603

FGGY Protein Vector (Mouse) (pPB-N-His)
PV179423	ABM	500 ng	EUR 603

FGGY Protein Vector (Mouse) (pPM-C-HA)
PV179424	ABM	500 ng	EUR 603

FGGY Protein Vector (Mouse) (pPM-C-His)
PV179425	ABM	500 ng	EUR 603

FGGY Protein Vector (Rat) (pPB-C-His)
PV268498	ABM	500 ng	EUR 603

FGGY Protein Vector (Rat) (pPB-N-His)
PV268499	ABM	500 ng	EUR 603

FGGY Protein Vector (Rat) (pPM-C-HA)
PV268500	ABM	500 ng	EUR 603

FGGY Protein Vector (Rat) (pPM-C-His)
PV268501	ABM	500 ng	EUR 603

FGGY Protein Vector (Human) (pPB-C-His)
PV016193	ABM	500 ng	EUR 329

FGGY Protein Vector (Human) (pPB-N-His)
PV016194	ABM	500 ng	EUR 329

FGGY Protein Vector (Human) (pPM-C-HA)
PV016195	ABM	500 ng	EUR 329

FGGY Protein Vector (Human) (pPM-C-His)
PV016196	ABM	500 ng	EUR 329

FGGY Protein Vector (Human) (pPB-C-His)
PV016197	ABM	500 ng	EUR 329

FGGY Protein Vector (Human) (pPB-N-His)
PV016198	ABM	500 ng	EUR 329

FGGY Protein Vector (Human) (pPM-C-HA)
PV016199	ABM	500 ng	EUR 329

FGGY Protein Vector (Human) (pPM-C-His)
PV016200	ABM	500 ng	EUR 329

Fggy 3'UTR GFP Stable Cell Line
TU156560	ABM	1.0 ml	Ask for price

Fggy 3'UTR Luciferase Stable Cell Line
TU106560	ABM	1.0 ml	Ask for price

Fggy 3'UTR Luciferase Stable Cell Line
TU204625	ABM	1.0 ml	Ask for price

Fggy 3'UTR GFP Stable Cell Line
TU254625	ABM	1.0 ml	Ask for price

FGGY 3'UTR GFP Stable Cell Line
TU057955	ABM	1.0 ml	EUR 1394

FGGY 3'UTR Luciferase Stable Cell Line
TU007955	ABM	1.0 ml	EUR 1394

Anti-FGGY carbohydrate kinase domain containing (3B9)
YF-MA18761	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to FGGY carbohydrate kinase domain containing

FGGY Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV710151	ABM	1.0 ug DNA	EUR 316

FGGY Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV710155	ABM	1.0 ug DNA	EUR 316

FGGY Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV710156	ABM	1.0 ug DNA	EUR 316

FGGY Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV635917	ABM	1.0 ug DNA	EUR 682

FGGY Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV635921	ABM	1.0 ug DNA	EUR 682

FGGY Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV635922	ABM	1.0 ug DNA	EUR 682

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul	SAB	50ul	EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul	SAB	100ul	EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul	SAB	50ul	EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul	SAB	100ul	EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul	SAB	50ul	EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul	SAB	100ul	EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul	SAB	50ul	EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul	SAB	100ul	EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul	SAB	50ul	EUR 187

FGGY Rabbit Polyclonal Antibody