Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG

fallback-image

FGGY Rabbit Polyclonal Antibody

FGGY Rabbit Polyclonal Antibody

Contact us: [email protected]

FGGY Polyclonal Antibody

ABP58552-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human FGGY protein at amino acid sequence of 491-540
  • Applications tips:
Description: A polyclonal antibody for detection of FGGY from Human. This FGGY antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FGGY protein at amino acid sequence of 491-540

FGGY Polyclonal Antibody

ES11426-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against FGGY from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

FGGY Polyclonal Antibody

ES11426-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against FGGY from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

FGGY Rabbit pAb

A14904-100ul 100 ul
EUR 308

FGGY Rabbit pAb

A14904-200ul 200 ul
EUR 459

FGGY Rabbit pAb

A14904-20ul 20 ul
EUR 183

FGGY Rabbit pAb

A14904-50ul 50 ul
EUR 223

FGGY Polyclonal Conjugated Antibody

C28752 100ul
EUR 397

Fggy antibody

70R-8778 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Fggy antibody

Polyclonal Fggy antibody - N-terminal region

APR11909G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Fggy - N-terminal region. This antibody is tested and proven to work in the following applications:

Anti-FGGY antibody

STJ117104 100 µl
EUR 277
Description: This gene encodes a protein that phosphorylates carbohydrates such as ribulose, ribitol, and L-arabinitol. Genome-wide association studies in some populations have found an association between polymorphisms in this gene and sporadic amyotrophic lateral sclerosis, but studies of other populations have not been able to replicate this association. Alternative splicing results in multiple transcript variants.

Anti-FGGY antibody

STJ192584 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to FGGY

FGGY siRNA

20-abx916860
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FGGY siRNA

20-abx916861
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pOTB7-FGGY

PVT18905 2 ug
EUR 231

Fggy Blocking Peptide

33R-6678 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Fggy antibody, catalog no. 70R-8778

FGGY cloning plasmid

CSB-CL853393HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1320
  • Sequence: atgtggctggaccatcgagcagtcagtcaagttaacaggatcaatgagaccaagcacagtgtcctccagtacgtcgggggggtgatgtctgtggaaatgcaggccccgaaacttctgtggctgaaagagaacttgagagagatttgctgggataaggcgggacatttctttgatc
  • Show more
Description: A cloning plasmid for the FGGY gene.

FGGY cloning plasmid

CSB-CL853393HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 759
  • Sequence: atggggatcagcaaagacccgatttttgtaccaggcgtctgggggccttatttctcagccatggtacctgggttctggctgaatgaaggtggtcagagcgttactggaaaattgatagaccacatggtacaaggccatgctgcttttccagaactacaagtaaaggccacagccag
  • Show more
Description: A cloning plasmid for the FGGY gene.

Human FGGY Carbohydrate Kinase Domain Containing (FGGY) ELISA Kit

abx384900-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse FGGY Carbohydrate Kinase Domain Containing (FGGY) ELISA Kit

abx389281-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Fggy ELISA KIT

ELI-26682m 96 Tests
EUR 865

FGGY ELISA KIT|Human

EF004978 96 Tests
EUR 689

Mouse FGGY shRNA Plasmid

20-abx978434
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human FGGY shRNA Plasmid

20-abx960616
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human FGGY ELISA KIT

ELI-47438h 96 Tests
EUR 824

FGGY Recombinant Protein (Human)

RP012145 100 ug Ask for price

FGGY Recombinant Protein (Human)

RP012148 100 ug Ask for price

FGGY Recombinant Protein (Rat)

RP201371 100 ug Ask for price

FGGY Recombinant Protein (Mouse)

RP134561 100 ug Ask for price

FGGY Recombinant Protein (Mouse)

RP134564 100 ug Ask for price

Fggy ORF Vector (Rat) (pORF)

ORF067125 1.0 ug DNA
EUR 506

FGGY ORF Vector (Human) (pORF)

ORF004049 1.0 ug DNA
EUR 95

FGGY ORF Vector (Human) (pORF)

ORF004050 1.0 ug DNA
EUR 95

Fggy ORF Vector (Mouse) (pORF)

ORF044855 1.0 ug DNA
EUR 506

Fggy ORF Vector (Mouse) (pORF)

ORF044856 1.0 ug DNA
EUR 506

Fggy sgRNA CRISPR Lentivector set (Rat)

K7423001 3 x 1.0 ug
EUR 339

FGGY sgRNA CRISPR Lentivector set (Human)

K0780701 3 x 1.0 ug
EUR 339

Fggy sgRNA CRISPR Lentivector set (Mouse)

K4105601 3 x 1.0 ug
EUR 339

anti-FGGY carbohydrate kinase domain containing

YF-PA19661 50 ul
EUR 363
Description: Mouse polyclonal to FGGY carbohydrate kinase domain containing

anti-FGGY carbohydrate kinase domain containing

YF-PA19662 50 ug
EUR 363
Description: Mouse polyclonal to FGGY carbohydrate kinase domain containing

anti-FGGY carbohydrate kinase domain containing

YF-PA19663 100 ug
EUR 403
Description: Rabbit polyclonal to FGGY carbohydrate kinase domain containing

anti-FGGY carbohydrate kinase domain containing

YF-PA26319 50 ul
EUR 334
Description: Mouse polyclonal to FGGY carbohydrate kinase domain containing

Fggy sgRNA CRISPR Lentivector (Rat) (Target 1)

K7423002 1.0 ug DNA
EUR 154

Fggy sgRNA CRISPR Lentivector (Rat) (Target 2)

K7423003 1.0 ug DNA
EUR 154

Fggy sgRNA CRISPR Lentivector (Rat) (Target 3)

K7423004 1.0 ug DNA
EUR 154

FGGY sgRNA CRISPR Lentivector (Human) (Target 1)

K0780702 1.0 ug DNA
EUR 154

FGGY sgRNA CRISPR Lentivector (Human) (Target 2)

K0780703 1.0 ug DNA
EUR 154

FGGY sgRNA CRISPR Lentivector (Human) (Target 3)

K0780704 1.0 ug DNA
EUR 154

Fggy sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4105602 1.0 ug DNA
EUR 154

Fggy sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4105603 1.0 ug DNA
EUR 154

Fggy sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4105604 1.0 ug DNA
EUR 154

FGGY Protein Vector (Mouse) (pPB-C-His)

PV179418 500 ng
EUR 603

FGGY Protein Vector (Mouse) (pPB-N-His)

PV179419 500 ng
EUR 603

FGGY Protein Vector (Mouse) (pPM-C-HA)

PV179420 500 ng
EUR 603

FGGY Protein Vector (Mouse) (pPM-C-His)

PV179421 500 ng
EUR 603

FGGY Protein Vector (Mouse) (pPB-C-His)

PV179422 500 ng
EUR 603

FGGY Protein Vector (Mouse) (pPB-N-His)

PV179423 500 ng
EUR 603

FGGY Protein Vector (Mouse) (pPM-C-HA)

PV179424 500 ng
EUR 603

FGGY Protein Vector (Mouse) (pPM-C-His)

PV179425 500 ng
EUR 603

FGGY Protein Vector (Rat) (pPB-C-His)

PV268498 500 ng
EUR 603

FGGY Protein Vector (Rat) (pPB-N-His)

PV268499 500 ng
EUR 603

FGGY Protein Vector (Rat) (pPM-C-HA)

PV268500 500 ng
EUR 603

FGGY Protein Vector (Rat) (pPM-C-His)

PV268501 500 ng
EUR 603

FGGY Protein Vector (Human) (pPB-C-His)

PV016193 500 ng
EUR 329

FGGY Protein Vector (Human) (pPB-N-His)

PV016194 500 ng
EUR 329

FGGY Protein Vector (Human) (pPM-C-HA)

PV016195 500 ng
EUR 329

FGGY Protein Vector (Human) (pPM-C-His)

PV016196 500 ng
EUR 329

FGGY Protein Vector (Human) (pPB-C-His)

PV016197 500 ng
EUR 329

FGGY Protein Vector (Human) (pPB-N-His)

PV016198 500 ng
EUR 329

FGGY Protein Vector (Human) (pPM-C-HA)

PV016199 500 ng
EUR 329

FGGY Protein Vector (Human) (pPM-C-His)

PV016200 500 ng
EUR 329

Fggy 3'UTR GFP Stable Cell Line

TU156560 1.0 ml Ask for price

Fggy 3'UTR Luciferase Stable Cell Line

TU106560 1.0 ml Ask for price

Fggy 3'UTR Luciferase Stable Cell Line

TU204625 1.0 ml Ask for price

Fggy 3'UTR GFP Stable Cell Line

TU254625 1.0 ml Ask for price

FGGY 3'UTR GFP Stable Cell Line

TU057955 1.0 ml
EUR 1394

FGGY 3'UTR Luciferase Stable Cell Line

TU007955 1.0 ml
EUR 1394

Anti-FGGY carbohydrate kinase domain containing (3B9)

YF-MA18761 100 ug
EUR 363
Description: Mouse monoclonal to FGGY carbohydrate kinase domain containing

FGGY Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV710151 1.0 ug DNA
EUR 316

FGGY Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV710155 1.0 ug DNA
EUR 316

FGGY Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV710156 1.0 ug DNA
EUR 316

FGGY Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV635917 1.0 ug DNA
EUR 682

FGGY Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV635921 1.0 ug DNA
EUR 682

FGGY Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV635922 1.0 ug DNA
EUR 682

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

FGGY Rabbit Polyclonal Antibody

Recent Posts

Categories

January 2022
M T W T F S S
 12
3456789
10111213141516
17181920212223
24252627282930
31  

Pages