Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG


ESAM Rabbit Polyclonal Antibody

ESAM Rabbit Polyclonal Antibody

Contact us: [email protected]

ESAM Polyclonal Antibody

ABP58502-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human ESAM protein
  • Applications tips:
Description: A polyclonal antibody for detection of ESAM from Human, Mouse, Rat. This ESAM antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ESAM protein

ESAM Polyclonal Antibody

ABP58502-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human ESAM protein
  • Applications tips:
Description: A polyclonal antibody for detection of ESAM from Human, Mouse, Rat. This ESAM antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ESAM protein

ESAM Polyclonal Antibody

ABP58502-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human ESAM protein
  • Applications tips:
Description: A polyclonal antibody for detection of ESAM from Human, Mouse, Rat. This ESAM antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ESAM protein

ESAM Polyclonal Antibody

A55335 100 µg
EUR 570.55
Description: kits suitable for this type of research

ESAM Polyclonal Antibody

ES11142-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ESAM from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

ESAM Polyclonal Antibody

ES11142-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ESAM from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

ESAM Rabbit pAb

A12210-100ul 100 ul
EUR 308

ESAM Rabbit pAb

A12210-200ul 200 ul
EUR 459

ESAM Rabbit pAb

A12210-20ul 20 ul
EUR 183

ESAM Rabbit pAb

A12210-50ul 50 ul
EUR 223

Human Endothelial Cell Adhesion Molecule (ESAM) ELISA Kit

EUR 517
  • Should the Human Endothelial Cell Adhesion Molecule (ESAM) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Endothelial Cell Adhesion Molecule (ESAM) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Endothelial Cell Adhesion Molecule (ESAM) ELISA Kit

EUR 673
  • Should the Human Endothelial Cell Adhesion Molecule (ESAM) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Endothelial Cell Adhesion Molecule (ESAM) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Endothelial Cell Adhesion Molecule (ESAM) ELISA Kit

RDR-ESAM-Hu-48Tests 48 Tests
EUR 544

Human Endothelial Cell Adhesion Molecule (ESAM) ELISA Kit

RDR-ESAM-Hu-96Tests 96 Tests
EUR 756

Human Endothelial Cell Adhesion Molecule (ESAM) ELISA Kit

RD-ESAM-Hu-48Tests 48 Tests
EUR 521

Human Endothelial Cell Adhesion Molecule (ESAM) ELISA Kit

RD-ESAM-Hu-96Tests 96 Tests
EUR 723

ESAM Polyclonal Conjugated Antibody

C27645 100ul
EUR 397

ESAM antibody

70R-17149 50 ul
EUR 435
Description: Rabbit polyclonal ESAM antibody

ESAM Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ESAM. Recognizes ESAM from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

ESAM Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against ESAM. Recognizes ESAM from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

ESAM Polyclonal Antibody, HRP Conjugated

A55336 100 µg
EUR 570.55
Description: fast delivery possible

ESAM Polyclonal Antibody, FITC Conjugated

A55337 100 µg
EUR 570.55
Description: reagents widely cited

ESAM Polyclonal Antibody, Biotin Conjugated

A55338 100 µg
EUR 570.55
Description: Ask the seller for details

anti- ESAM antibody

FNab02860 100µg
EUR 548.75
  • Immunogen: endothelial cell adhesion molecule
  • Uniprot ID: Q96AP7
  • Gene ID: 90952
  • Research Area: Immunology, Cardiovascular
Description: Antibody raised against ESAM

Anti-ESAM antibody

PAab02860 100 ug
EUR 386

Anti-ESAM antibody

STJ114102 100 µl
EUR 277

Anti-ESAM antibody

STJ192300 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ESAM

Esam/ Rat Esam ELISA Kit

ELI-20559r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA21677 50 ug
EUR 363
Description: Mouse polyclonal to ESAM


YF-PA21678 100 ul
EUR 403
Description: Rabbit polyclonal to ESAM


YF-PA21679 100 ug
EUR 403
Description: Rabbit polyclonal to ESAM

ESAM Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ESAM. Recognizes ESAM from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ESAM Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ESAM. Recognizes ESAM from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ESAM Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ESAM. Recognizes ESAM from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Endothelial Cell Adhesion Molecule (ESAM) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ESAM (Leu31~Val390)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelial Cell Adhesion Molecule (ESAM)

Endothelial Cell Adhesion Molecule (ESAM) Polyclonal Antibody (Mouse)

  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ESAM (Ala29~Ser248)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Adhesion Molecule (ESAM)

Endothelial Cell Adhesion Molecule (ESAM) Polyclonal Antibody (Rat)

  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ESAM (Met31~Ala251)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Endothelial Cell Adhesion Molecule (ESAM)

ESAM cloning plasmid

CSB-CL850258HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1173
  • Sequence: atgatttccctcccggggcccctggtgaccaacttgctgcggtttttgttcctggggctgagtgccctcgcgcccccctcgcgggcccagctgcaactgcacttgcccgccaaccggttgcaggcggtggagggaggggaagtggtgcttccagcgtggtacaccttgcacgggg
  • Show more
Description: A cloning plasmid for the ESAM gene.

Anti-ESAM (1G8)

YF-MA19632 100 ug
EUR 363
Description: Mouse monoclonal to ESAM

Anti-ESAM (1E4)

YF-MA19633 100 ug
EUR 363
Description: Mouse monoclonal to ESAM

Endothelial Cell Adhesion Molecule (ESAM) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ESAM (Leu31~Val390)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelial Cell Adhesion Molecule (ESAM). This antibody is labeled with APC.

Endothelial Cell Adhesion Molecule (ESAM) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ESAM (Leu31~Val390)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelial Cell Adhesion Molecule (ESAM). This antibody is labeled with Biotin.

Endothelial Cell Adhesion Molecule (ESAM) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ESAM (Leu31~Val390)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelial Cell Adhesion Molecule (ESAM). This antibody is labeled with Cy3.

Endothelial Cell Adhesion Molecule (ESAM) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ESAM (Leu31~Val390)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelial Cell Adhesion Molecule (ESAM). This antibody is labeled with FITC.

Endothelial Cell Adhesion Molecule (ESAM) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ESAM (Leu31~Val390)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelial Cell Adhesion Molecule (ESAM). This antibody is labeled with HRP.

Endothelial Cell Adhesion Molecule (ESAM) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ESAM (Leu31~Val390)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelial Cell Adhesion Molecule (ESAM). This antibody is labeled with PE.

Endothelial Cell Adhesion Molecule (ESAM) Polyclonal Antibody (Mouse), APC

  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ESAM (Ala29~Ser248)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Adhesion Molecule (ESAM). This antibody is labeled with APC.

Endothelial Cell Adhesion Molecule (ESAM) Polyclonal Antibody (Mouse), Biotinylated

  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ESAM (Ala29~Ser248)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Adhesion Molecule (ESAM). This antibody is labeled with Biotin.

Endothelial Cell Adhesion Molecule (ESAM) Polyclonal Antibody (Mouse), Cy3

  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ESAM (Ala29~Ser248)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Adhesion Molecule (ESAM). This antibody is labeled with Cy3.

Endothelial Cell Adhesion Molecule (ESAM) Polyclonal Antibody (Mouse), FITC

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ESAM (Ala29~Ser248)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Adhesion Molecule (ESAM). This antibody is labeled with FITC.

Endothelial Cell Adhesion Molecule (ESAM) Polyclonal Antibody (Mouse), HRP

  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ESAM (Ala29~Ser248)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Adhesion Molecule (ESAM). This antibody is labeled with HRP.

Endothelial Cell Adhesion Molecule (ESAM) Polyclonal Antibody (Mouse), PE

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ESAM (Ala29~Ser248)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Adhesion Molecule (ESAM). This antibody is labeled with PE.

Endothelial Cell Adhesion Molecule (ESAM) Polyclonal Antibody (Rat), APC

  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ESAM (Met31~Ala251)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Endothelial Cell Adhesion Molecule (ESAM). This antibody is labeled with APC.

Endothelial Cell Adhesion Molecule (ESAM) Polyclonal Antibody (Rat), Biotinylated

  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ESAM (Met31~Ala251)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Endothelial Cell Adhesion Molecule (ESAM). This antibody is labeled with Biotin.

Endothelial Cell Adhesion Molecule (ESAM) Polyclonal Antibody (Rat), Cy3

  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ESAM (Met31~Ala251)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Endothelial Cell Adhesion Molecule (ESAM). This antibody is labeled with Cy3.

Endothelial Cell Adhesion Molecule (ESAM) Polyclonal Antibody (Rat), FITC

  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ESAM (Met31~Ala251)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Endothelial Cell Adhesion Molecule (ESAM). This antibody is labeled with FITC.

Endothelial Cell Adhesion Molecule (ESAM) Polyclonal Antibody (Rat), HRP

  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ESAM (Met31~Ala251)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Endothelial Cell Adhesion Molecule (ESAM). This antibody is labeled with HRP.

Endothelial Cell Adhesion Molecule (ESAM) Polyclonal Antibody (Rat), PE

  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ESAM (Met31~Ala251)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Endothelial Cell Adhesion Molecule (ESAM). This antibody is labeled with PE.

Endothelial Cell Adhesion Molecule (ESAM) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Endothelial Cell Adhesion Molecule (ESAM) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

ESAM Rabbit Polyclonal Antibody

Recent Posts


January 2022
