ESAM Rabbit Polyclonal Antibody

Contact us: [email protected]

ESAM Polyclonal Antibody
ABP58502-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human ESAM protein Applications tips:
Description: A polyclonal antibody for detection of ESAM from Human, Mouse, Rat. This ESAM antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ESAM protein

ESAM Polyclonal Antibody
ABP58502-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human ESAM protein Applications tips:
Description: A polyclonal antibody for detection of ESAM from Human, Mouse, Rat. This ESAM antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ESAM protein

ESAM Polyclonal Antibody
ABP58502-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human ESAM protein Applications tips:
Description: A polyclonal antibody for detection of ESAM from Human, Mouse, Rat. This ESAM antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ESAM protein

ESAM Polyclonal Antibody
A55335	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

ESAM Polyclonal Antibody
ES11142-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ESAM from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

ESAM Polyclonal Antibody
ES11142-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ESAM from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

ESAM Rabbit pAb
A12210-100ul	Abclonal	100 ul	EUR 308

ESAM Rabbit pAb
A12210-200ul	Abclonal	200 ul	EUR 459

ESAM Rabbit pAb
A12210-20ul	Abclonal	20 ul	EUR 183

ESAM Rabbit pAb
A12210-50ul	Abclonal	50 ul	EUR 223

Human Endothelial Cell Adhesion Molecule (ESAM) ELISA Kit
DLR-ESAM-Hu-48T	DL Develop	48T	EUR 517
Should the Human Endothelial Cell Adhesion Molecule (ESAM) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Endothelial Cell Adhesion Molecule (ESAM) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Endothelial Cell Adhesion Molecule (ESAM) ELISA Kit
DLR-ESAM-Hu-96T	DL Develop	96T	EUR 673
Should the Human Endothelial Cell Adhesion Molecule (ESAM) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Endothelial Cell Adhesion Molecule (ESAM) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Endothelial Cell Adhesion Molecule (ESAM) ELISA Kit
RDR-ESAM-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Endothelial Cell Adhesion Molecule (ESAM) ELISA Kit
RDR-ESAM-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Endothelial Cell Adhesion Molecule (ESAM) ELISA Kit
RD-ESAM-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Endothelial Cell Adhesion Molecule (ESAM) ELISA Kit
RD-ESAM-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

ESAM Polyclonal Conjugated Antibody
C27645	SAB	100ul	EUR 397

ESAM antibody
70R-17149	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal ESAM antibody

ESAM Antibody
1-CSB-PA850258LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ESAM. Recognizes ESAM from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

ESAM Antibody
1-CSB-PA007818GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against ESAM. Recognizes ESAM from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

ESAM Polyclonal Antibody, HRP Conjugated
A55336	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

ESAM Polyclonal Antibody, FITC Conjugated
A55337	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

ESAM Polyclonal Antibody, Biotin Conjugated
A55338	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

anti- ESAM antibody
FNab02860	FN Test	100µg	EUR 548.75
Immunogen: endothelial cell adhesion molecule Uniprot ID: Q96AP7 Gene ID: 90952 Research Area: Immunology, Cardiovascular
Description: Antibody raised against ESAM

Anti-ESAM antibody
PAab02860	Lifescience Market	100 ug	EUR 386

Anti-ESAM antibody
STJ114102	St John's Laboratory	100 µl	EUR 277

Anti-ESAM antibody
STJ192300	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to ESAM

Esam/ Rat Esam ELISA Kit
ELI-20559r	Lifescience Market	96 Tests	EUR 886

ESAM siRNA
20-abx901776	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ESAM siRNA
20-abx915678	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ESAM siRNA
20-abx915679	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-ESAM
YF-PA21677	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to ESAM

anti-ESAM
YF-PA21678	Abfrontier	100 ul	EUR 403
Description: Rabbit polyclonal to ESAM

anti-ESAM
YF-PA21679	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to ESAM

ESAM Antibody, HRP conjugated
1-CSB-PA850258LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ESAM. Recognizes ESAM from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ESAM Antibody, FITC conjugated
1-CSB-PA850258LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ESAM. Recognizes ESAM from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ESAM Antibody, Biotin conjugated
1-CSB-PA850258LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ESAM. Recognizes ESAM from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Endothelial Cell Adhesion Molecule (ESAM) Polyclonal Antibody (Human)
4-PAE536Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ESAM (Leu31~Val390) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelial Cell Adhesion Molecule (ESAM)

Endothelial Cell Adhesion Molecule (ESAM) Polyclonal Antibody (Mouse)
4-PAE536Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ESAM (Ala29~Ser248) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Adhesion Molecule (ESAM)

Endothelial Cell Adhesion Molecule (ESAM) Polyclonal Antibody (Rat)
4-PAE536Ra01	Cloud-Clone	EUR 259.00 EUR 2708.00 EUR 670.00 EUR 328.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ESAM (Met31~Ala251) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Endothelial Cell Adhesion Molecule (ESAM)

ESAM cloning plasmid
CSB-CL850258HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1173 Sequence: atgatttccctcccggggcccctggtgaccaacttgctgcggtttttgttcctggggctgagtgccctcgcgcccccctcgcgggcccagctgcaactgcacttgcccgccaaccggttgcaggcggtggagggaggggaagtggtgcttccagcgtggtacaccttgcacgggg Show more
Description: A cloning plasmid for the ESAM gene.

Anti-ESAM (1G8)
YF-MA19632	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to ESAM

Anti-ESAM (1E4)
YF-MA19633	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to ESAM

Endothelial Cell Adhesion Molecule (ESAM) Polyclonal Antibody (Human), APC
4-PAE536Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ESAM (Leu31~Val390) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelial Cell Adhesion Molecule (ESAM). This antibody is labeled with APC.

Endothelial Cell Adhesion Molecule (ESAM) Polyclonal Antibody (Human), Biotinylated
4-PAE536Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ESAM (Leu31~Val390) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelial Cell Adhesion Molecule (ESAM). This antibody is labeled with Biotin.

Endothelial Cell Adhesion Molecule (ESAM) Polyclonal Antibody (Human), Cy3
4-PAE536Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ESAM (Leu31~Val390) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelial Cell Adhesion Molecule (ESAM). This antibody is labeled with Cy3.

Endothelial Cell Adhesion Molecule (ESAM) Polyclonal Antibody (Human), FITC
4-PAE536Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ESAM (Leu31~Val390) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelial Cell Adhesion Molecule (ESAM). This antibody is labeled with FITC.

Endothelial Cell Adhesion Molecule (ESAM) Polyclonal Antibody (Human), HRP
4-PAE536Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ESAM (Leu31~Val390) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelial Cell Adhesion Molecule (ESAM). This antibody is labeled with HRP.

Endothelial Cell Adhesion Molecule (ESAM) Polyclonal Antibody (Human), PE
4-PAE536Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ESAM (Leu31~Val390) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelial Cell Adhesion Molecule (ESAM). This antibody is labeled with PE.

Endothelial Cell Adhesion Molecule (ESAM) Polyclonal Antibody (Mouse), APC
4-PAE536Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ESAM (Ala29~Ser248) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Adhesion Molecule (ESAM). This antibody is labeled with APC.

Endothelial Cell Adhesion Molecule (ESAM) Polyclonal Antibody (Mouse), Biotinylated
4-PAE536Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ESAM (Ala29~Ser248) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Adhesion Molecule (ESAM). This antibody is labeled with Biotin.

Endothelial Cell Adhesion Molecule (ESAM) Polyclonal Antibody (Mouse), Cy3
4-PAE536Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ESAM (Ala29~Ser248) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Adhesion Molecule (ESAM). This antibody is labeled with Cy3.

Endothelial Cell Adhesion Molecule (ESAM) Polyclonal Antibody (Mouse), FITC
4-PAE536Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ESAM (Ala29~Ser248) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Adhesion Molecule (ESAM). This antibody is labeled with FITC.

Endothelial Cell Adhesion Molecule (ESAM) Polyclonal Antibody (Mouse), HRP
4-PAE536Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ESAM (Ala29~Ser248) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Adhesion Molecule (ESAM). This antibody is labeled with HRP.

Endothelial Cell Adhesion Molecule (ESAM) Polyclonal Antibody (Mouse), PE
4-PAE536Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ESAM (Ala29~Ser248) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Adhesion Molecule (ESAM). This antibody is labeled with PE.

Endothelial Cell Adhesion Molecule (ESAM) Polyclonal Antibody (Rat), APC
4-PAE536Ra01-APC	Cloud-Clone	EUR 364.00 EUR 3545.00 EUR 980.00 EUR 467.00 EUR 227.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ESAM (Met31~Ala251) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Endothelial Cell Adhesion Molecule (ESAM). This antibody is labeled with APC.

Endothelial Cell Adhesion Molecule (ESAM) Polyclonal Antibody (Rat), Biotinylated
4-PAE536Ra01-Biotin	Cloud-Clone	EUR 325.00 EUR 2658.00 EUR 777.00 EUR 400.00 EUR 225.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ESAM (Met31~Ala251) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Endothelial Cell Adhesion Molecule (ESAM). This antibody is labeled with Biotin.

Endothelial Cell Adhesion Molecule (ESAM) Polyclonal Antibody (Rat), Cy3
4-PAE536Ra01-Cy3	Cloud-Clone	EUR 444.00 EUR 4685.00 EUR 1265.00 EUR 581.00 EUR 261.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ESAM (Met31~Ala251) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Endothelial Cell Adhesion Molecule (ESAM). This antibody is labeled with Cy3.

Endothelial Cell Adhesion Molecule (ESAM) Polyclonal Antibody (Rat), FITC
4-PAE536Ra01-FITC	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ESAM (Met31~Ala251) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Endothelial Cell Adhesion Molecule (ESAM). This antibody is labeled with FITC.

Endothelial Cell Adhesion Molecule (ESAM) Polyclonal Antibody (Rat), HRP
4-PAE536Ra01-HRP	Cloud-Clone	EUR 332.00 EUR 3089.00 EUR 866.00 EUR 421.00 EUR 213.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ESAM (Met31~Ala251) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Endothelial Cell Adhesion Molecule (ESAM). This antibody is labeled with HRP.

Endothelial Cell Adhesion Molecule (ESAM) Polyclonal Antibody (Rat), PE
4-PAE536Ra01-PE	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ESAM (Met31~Ala251) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Endothelial Cell Adhesion Molecule (ESAM). This antibody is labeled with PE.

Endothelial Cell Adhesion Molecule (ESAM) Antibody
20-abx103577	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Endothelial Cell Adhesion Molecule (ESAM) Antibody
20-abx103578	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

ESAM Rabbit Polyclonal Antibody