ITLN1 Rabbit Polyclonal Antibody

Contact us: [email protected]

ITLN1 Polyclonal Antibody
ABP58982-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human ITLN1 protein at amino acid sequence of 110-190 Applications tips:
Description: A polyclonal antibody for detection of ITLN1 from Human. This ITLN1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ITLN1 protein at amino acid sequence of 110-190

ITLN1 Polyclonal Antibody
ES11184-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ITLN1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

ITLN1 Polyclonal Antibody
ES11184-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ITLN1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human Intelectin 1 (ITLN1) ELISA Kit
DLR-ITLN1-Hu-48T	DL Develop	48T	EUR 479
Should the Human Intelectin 1 (ITLN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Intelectin 1 (ITLN1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Intelectin 1 (ITLN1) ELISA Kit
DLR-ITLN1-Hu-96T	DL Develop	96T	EUR 621
Should the Human Intelectin 1 (ITLN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Intelectin 1 (ITLN1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Intelectin 1 (ITLN1) ELISA Kit
DLR-ITLN1-Mu-48T	DL Develop	48T	EUR 489
Should the Mouse Intelectin 1 (ITLN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Intelectin 1 (ITLN1) in samples from serum, plasma or other biological fluids.

Mouse Intelectin 1 (ITLN1) ELISA Kit
DLR-ITLN1-Mu-96T	DL Develop	96T	EUR 635
Should the Mouse Intelectin 1 (ITLN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Intelectin 1 (ITLN1) in samples from serum, plasma or other biological fluids.

Rat Intelectin 1 (ITLN1) ELISA Kit
DLR-ITLN1-Ra-48T	DL Develop	48T	EUR 508
Should the Rat Intelectin 1 (ITLN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Intelectin 1 (ITLN1) in samples from serum, plasma or other biological fluids.

Rat Intelectin 1 (ITLN1) ELISA Kit
DLR-ITLN1-Ra-96T	DL Develop	96T	EUR 661
Should the Rat Intelectin 1 (ITLN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Intelectin 1 (ITLN1) in samples from serum, plasma or other biological fluids.

Human Intelectin 1 (ITLN1) ELISA Kit
RDR-ITLN1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Intelectin 1 (ITLN1) ELISA Kit
RDR-ITLN1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Mouse Intelectin 1 (ITLN1) ELISA Kit
RDR-ITLN1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 511

Mouse Intelectin 1 (ITLN1) ELISA Kit
RDR-ITLN1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 709

Rat Intelectin 1 (ITLN1) ELISA Kit
RDR-ITLN1-Ra-48Tests	Reddot Biotech	48 Tests	EUR 534

Rat Intelectin 1 (ITLN1) ELISA Kit
RDR-ITLN1-Ra-96Tests	Reddot Biotech	96 Tests	EUR 742

Human Intelectin 1 (ITLN1) ELISA Kit
RD-ITLN1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 478

Human Intelectin 1 (ITLN1) ELISA Kit
RD-ITLN1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 662

Mouse Intelectin 1 (ITLN1) ELISA Kit
RD-ITLN1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 489

Mouse Intelectin 1 (ITLN1) ELISA Kit
RD-ITLN1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 677

Rat Intelectin 1 (ITLN1) ELISA Kit
RD-ITLN1-Ra-48Tests	Reddot Biotech	48 Tests	EUR 511

Rat Intelectin 1 (ITLN1) ELISA Kit
RD-ITLN1-Ra-96Tests	Reddot Biotech	96 Tests	EUR 709

ITLN1 Rabbit pAb
A7234-100ul	Abclonal	100 ul	EUR 308

ITLN1 Rabbit pAb
A7234-200ul	Abclonal	200 ul	EUR 459

ITLN1 Rabbit pAb
A7234-20ul	Abclonal	20 ul	EUR 183

ITLN1 Rabbit pAb
A7234-50ul	Abclonal	50 ul	EUR 223

ITLN1 antibody
70R-18032	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal ITLN1 antibody

ITLN1 Antibody
36560-100ul	SAB	100ul	EUR 252

ITLN1 antibody
10R-10234	Fitzgerald	50 ul	EUR 241
Description: Mouse monoclonal ITLN1 antibody

ITLN1 antibody
10R-10369	Fitzgerald	100 ug	EUR 435
Description: Mouse monoclonal ITLN1 antibody

ITLN1 Antibody
DF12413	Affbiotech	200ul	EUR 304
Description: ITLN1 antibody detects endogenous levels of ITLN1.

ITLN1 Antibody
1-CSB-PA522045	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ITLN1. Recognizes ITLN1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:10000, WB:1:1000-1:5000

ITLN1 antibody
70R-8512	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal ITLN1 antibody

ITLN1 Antibody
1-CSB-PA011901GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against ITLN1. Recognizes ITLN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

ITLN1
E541-336	EnoGene	100ug	EUR 343

Polyclonal ITLN1 / Omentin Antibody (aa27-168)
APR08047G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ITLN1 / Omentin (aa27-168). This antibody is tested and proven to work in the following applications:

Intelectin 1 (ITLN1) Polyclonal Antibody (Mouse)
4-PAA933Mu01	Cloud-Clone	EUR 236.00 EUR 2338.00 EUR 586.00 EUR 294.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ITLN1 (Arg28~Gly270) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Intelectin 1 (ITLN1)

Intelectin 1 (ITLN1) Polyclonal Antibody (Rat)
4-PAA933Ra01	Cloud-Clone	EUR 243.00 EUR 2457.00 EUR 613.00 EUR 305.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ITLN1 (Ser101~Gly292) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Intelectin 1 (ITLN1)

ITLN1 Conjugated Antibody
C36560	SAB	100ul	EUR 397

anti- ITLN1 antibody
FNab04415	FN Test	100µg	EUR 505.25
Immunogen: intelectin 1(galactofuranose binding) Uniprot ID: Q8WWA0 Gene ID: 55600 Research Area: Immunology, Cardiovascular, Signal Transduction
Description: Antibody raised against ITLN1

Anti-ITLN1 antibody
PAab04415	Lifescience Market	100 ug	EUR 355

Anti-ITLN1 Antibody
PB10004	BosterBio	100ug/vial	EUR 334

Anti-ITLN1 antibody
STJ29314	St John's Laboratory	100 µl	EUR 277

Anti-ITLN1 antibody
STJ192342	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to ITLN1

Intelectin 1 (ITLN1) Polyclonal Antibody (Human, Mouse)
4-PAA933Hu01	Cloud-Clone	EUR 232.00 EUR 2285.00 EUR 574.00 EUR 289.00 EUR 208.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ITLN1 (Cys31~Gly253) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Intelectin 1 (ITLN1)

Intelectin 1 (ITLN1) Polyclonal Antibody (Mouse), APC
4-PAA933Mu01-APC	Cloud-Clone	EUR 329.00 EUR 3041.00 EUR 854.00 EUR 416.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ITLN1 (Arg28~Gly270) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Intelectin 1 (ITLN1). This antibody is labeled with APC.

Intelectin 1 (ITLN1) Polyclonal Antibody (Mouse), Biotinylated
4-PAA933Mu01-Biotin	Cloud-Clone	EUR 299.00 EUR 2288.00 EUR 684.00 EUR 363.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ITLN1 (Arg28~Gly270) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Intelectin 1 (ITLN1). This antibody is labeled with Biotin.

Intelectin 1 (ITLN1) Polyclonal Antibody (Mouse), Cy3
4-PAA933Mu01-Cy3	Cloud-Clone	EUR 397.00 EUR 4013.00 EUR 1097.00 EUR 513.00 EUR 241.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ITLN1 (Arg28~Gly270) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Intelectin 1 (ITLN1). This antibody is labeled with Cy3.

Intelectin 1 (ITLN1) Polyclonal Antibody (Mouse), FITC
4-PAA933Mu01-FITC	Cloud-Clone	EUR 283.00 EUR 2452.00 EUR 703.00 EUR 353.00 EUR 189.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ITLN1 (Arg28~Gly270) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Intelectin 1 (ITLN1). This antibody is labeled with FITC.

Intelectin 1 (ITLN1) Polyclonal Antibody (Mouse), HRP
4-PAA933Mu01-HRP	Cloud-Clone	EUR 302.00 EUR 2652.00 EUR 756.00 EUR 377.00 EUR 200.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ITLN1 (Arg28~Gly270) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Intelectin 1 (ITLN1). This antibody is labeled with HRP.

Intelectin 1 (ITLN1) Polyclonal Antibody (Mouse), PE
4-PAA933Mu01-PE	Cloud-Clone	EUR 283.00 EUR 2452.00 EUR 703.00 EUR 353.00 EUR 189.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ITLN1 (Arg28~Gly270) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Intelectin 1 (ITLN1). This antibody is labeled with PE.

Intelectin 1 (ITLN1) Polyclonal Antibody (Rat), APC
4-PAA933Ra01-APC	Cloud-Clone	EUR 340.00 EUR 3203.00 EUR 894.00 EUR 432.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ITLN1 (Ser101~Gly292) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Intelectin 1 (ITLN1). This antibody is labeled with APC.

Intelectin 1 (ITLN1) Polyclonal Antibody (Rat), Biotinylated
4-PAA933Ra01-Biotin	Cloud-Clone	EUR 307.00 EUR 2407.00 EUR 714.00 EUR 375.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ITLN1 (Ser101~Gly292) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Intelectin 1 (ITLN1). This antibody is labeled with Biotin.

Intelectin 1 (ITLN1) Polyclonal Antibody (Rat), Cy3
4-PAA933Ra01-Cy3	Cloud-Clone	EUR 411.00 EUR 4229.00 EUR 1151.00 EUR 535.00 EUR 248.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ITLN1 (Ser101~Gly292) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Intelectin 1 (ITLN1). This antibody is labeled with Cy3.

Intelectin 1 (ITLN1) Polyclonal Antibody (Rat), FITC
4-PAA933Ra01-FITC	Cloud-Clone	EUR 292.00 EUR 2582.00 EUR 735.00 EUR 366.00 EUR 194.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ITLN1 (Ser101~Gly292) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Intelectin 1 (ITLN1). This antibody is labeled with FITC.

Intelectin 1 (ITLN1) Polyclonal Antibody (Rat), HRP
4-PAA933Ra01-HRP	Cloud-Clone	EUR 311.00 EUR 2792.00 EUR 791.00 EUR 391.00 EUR 205.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ITLN1 (Ser101~Gly292) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Intelectin 1 (ITLN1). This antibody is labeled with HRP.

Intelectin 1 (ITLN1) Polyclonal Antibody (Rat), PE
4-PAA933Ra01-PE	Cloud-Clone	EUR 292.00 EUR 2582.00 EUR 735.00 EUR 366.00 EUR 194.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ITLN1 (Ser101~Gly292) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Intelectin 1 (ITLN1). This antibody is labeled with PE.

ITLN1 protein
30R-2075	Fitzgerald	100 ug	EUR 305
Description: Purified recombinant ITLN1 protein

ITLN1 Protein
20-abx262977	Abbexa	EUR 328.00 EUR 6425.00 EUR 230.00	10 ug 1 mg 2 µg
Shipped within 5-10 working days.

ITLN1 Protein
20-abx263032	Abbexa	EUR 328.00 EUR 7358.00 EUR 230.00	10 ug 1 mg 2 µg
Shipped within 5-10 working days.

ITLN1 siRNA
20-abx920954	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ITLN1 siRNA
20-abx920955	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Intelectin 1 (ITLN1) Antibody
20-abx177019	Abbexa	EUR 1135.00 EUR 551.00	1 mg 200 ug
Please enquire.

Intelectin 1 (ITLN1) Antibody
20-abx212528	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Intelectin 1 (ITLN1) Antibody
20-abx101091	Abbexa	EUR 398.00 EUR 133.00 EUR 1107.00 EUR 537.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Intelectin 1 (ITLN1) Antibody
20-abx101092	Abbexa	EUR 411.00 EUR 133.00 EUR 1135.00 EUR 551.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Intelectin 1 (ITLN1) Antibody
20-abx101093	Abbexa	EUR 425.00 EUR 133.00 EUR 1177.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Intelectin 1 (ITLN1) Antibody
20-abx172967	Abbexa	EUR 787.00 EUR 411.00	1 mg 200 ug
Please enquire.

Intelectin 1 (ITLN1) Antibody
20-abx172968	Abbexa	EUR 843.00 EUR 439.00	1 mg 200 ug
Please enquire.

Intelectin 1 (ITLN1) Polyclonal Antibody (Human, Mouse), APC
4-PAA933Hu01-APC	Cloud-Clone	EUR 323.00 EUR 2969.00 EUR 836.00 EUR 409.00 EUR 210.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ITLN1 (Cys31~Gly253) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Intelectin 1 (ITLN1). This antibody is labeled with APC.

Intelectin 1 (ITLN1) Polyclonal Antibody (Human, Mouse), Biotinylated
4-PAA933Hu01-Biotin	Cloud-Clone	EUR 295.00 EUR 2235.00 EUR 671.00 EUR 358.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ITLN1 (Cys31~Gly253) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Intelectin 1 (ITLN1). This antibody is labeled with Biotin.

Intelectin 1 (ITLN1) Polyclonal Antibody (Human, Mouse), Cy3
4-PAA933Hu01-Cy3	Cloud-Clone	EUR 390.00 EUR 3917.00 EUR 1073.00 EUR 504.00 EUR 239.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ITLN1 (Cys31~Gly253) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Intelectin 1 (ITLN1). This antibody is labeled with Cy3.

Intelectin 1 (ITLN1) Polyclonal Antibody (Human, Mouse), FITC
4-PAA933Hu01-FITC	Cloud-Clone	EUR 279.00 EUR 2395.00 EUR 688.00 EUR 347.00 EUR 188.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ITLN1 (Cys31~Gly253) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Intelectin 1 (ITLN1). This antibody is labeled with FITC.

Intelectin 1 (ITLN1) Polyclonal Antibody (Human, Mouse), HRP
4-PAA933Hu01-HRP	Cloud-Clone	EUR 297.00 EUR 2589.00 EUR 741.00 EUR 371.00 EUR 199.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ITLN1 (Cys31~Gly253) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Intelectin 1 (ITLN1). This antibody is labeled with HRP.

Intelectin 1 (ITLN1) Polyclonal Antibody (Human, Mouse), PE
4-PAA933Hu01-PE	Cloud-Clone	EUR 279.00 EUR 2395.00 EUR 688.00 EUR 347.00 EUR 188.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ITLN1 (Cys31~Gly253) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Intelectin 1 (ITLN1). This antibody is labeled with PE.

Intelectin 1 (ITLN1) Polyclonal Antibody (Mouse), APC-Cy7
4-PAA933Mu01-APC-Cy7	Cloud-Clone	EUR 538.00 EUR 5962.00 EUR 1588.00 EUR 713.00 EUR 304.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ITLN1 (Arg28~Gly270) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Intelectin 1 (ITLN1). This antibody is labeled with APC-Cy7.

Intelectin 1 (ITLN1) Polyclonal Antibody (Rat), APC-Cy7
4-PAA933Ra01-APC-Cy7	Cloud-Clone	EUR 560.00 EUR 6286.00 EUR 1669.00 EUR 745.00 EUR 315.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ITLN1 (Ser101~Gly292) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Intelectin 1 (ITLN1). This antibody is labeled with APC-Cy7.

Rabbit Intelectin 1/Omentin (ITLN1) ELISA Kit
abx362579-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

ITLN1 Blocking Peptide
33R-10022	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ITLN1 antibody, catalog no. 70R-8512

ITLN1 Blocking Peptide
DF12413-BP	Affbiotech	1mg	EUR 195

Human ITLN1 Protein
abx060058-100ug	Abbexa	100 ug	EUR 328
Shipped within 5-10 working days.

ITLN1 cloning plasmid
CSB-CL851976HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 942 Sequence: atgaaccaactcagcttcctgctgtttctcatagcgaccaccagaggatggagtacagatgaggctaatacttacttcaaggaatggacctgttcttcgtctccatctctgcccagaagctgcaaggaaatcaaagacgaatgtcctagtgcatttgatggcctgtattttctccg Show more
Description: A cloning plasmid for the ITLN1 gene.

Intelectin 1/Omentin (ITLN1) Antibody
20-abx005461	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Intelectin 1/Omentin (ITLN1) Antibody
20-abx113197	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Intelectin 1/Omentin (ITLN1) Antibody
abx036572-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Intelectin 1/Omentin (ITLN1) Antibody
20-abx137227	Abbexa	EUR 704.00 EUR 328.00 EUR 230.00	100 ug 20 ug 5 ug
Shipped within 5-10 working days.

Intelectin 1 (ITLN1) Antibody (Biotin)
20-abx272759	Abbexa	EUR 425.00 EUR 230.00 EUR 1219.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Intelectin 1 (ITLN1) Antibody (Biotin)
20-abx273225	Abbexa	EUR 453.00 EUR 244.00 EUR 1288.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Intelectin 1/Omentin (ITLN1) Antibody
abx234415-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Intelectin 1/Omentin (ITLN1) Antibody
20-abx225255	Abbexa	EUR 370.00 EUR 606.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Intelectin 1 (ITLN1) Polyclonal Antibody (Human, Mouse), APC-Cy7
4-PAA933Hu01-APC-Cy7	Cloud-Clone	EUR 527.00 EUR 5818.00 EUR 1552.00 EUR 698.00 EUR 301.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ITLN1 (Cys31~Gly253) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Intelectin 1 (ITLN1). This antibody is labeled with APC-Cy7.

ITLN1 298 a.a. Protein
20-abx260698	Abbexa	EUR 3418.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.

Human ITLN1 ELISA Kit
ELA-E0933h	Lifescience Market	96 Tests	EUR 824

ITLN1 ELISA KIT|Human
EF000363	Lifescience Market	96 Tests	EUR 689

Human ITLN1 shRNA Plasmid
20-abx960760	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse ITLN1 shRNA Plasmid
20-abx971107	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Recombinant Intelectin 1 (ITLN1)
4-RPA933Hu01	Cloud-Clone	EUR 467.36 EUR 228.00 EUR 1477.60 EUR 559.20 EUR 1018.40 EUR 376.00 EUR 3544.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q8WWA0 Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 28.4kDa Isoelectric Point: 7.2
Description: Recombinant Human Intelectin 1 expressed in: E.coli

Recombinant Intelectin 1 (ITLN1)
4-RPA933Mu01	Cloud-Clone	EUR 492.45 EUR 235.00 EUR 1571.68 EUR 590.56 EUR 1081.12 EUR 392.00 EUR 3779.20	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: O88310 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 28.7kDa Isoelectric Point: 8.8
Description: Recombinant Mouse Intelectin 1 expressed in: E.coli

Recombinant Intelectin 1 (ITLN1)
4-RPA933Ra01	Cloud-Clone	EUR 485.28 EUR 233.00 EUR 1544.80 EUR 581.60 EUR 1063.20 EUR 388.00 EUR 3712.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q499T8 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 22.4kDa Isoelectric Point: Inquire
Description: Recombinant Rat Intelectin 1 expressed in: E.coli

ITLN1 Rabbit Polyclonal Antibody