Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG

fallback-image

ITLN1 Rabbit Polyclonal Antibody

ITLN1 Rabbit Polyclonal Antibody

Contact us: [email protected]

ITLN1 Polyclonal Antibody

ABP58982-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human ITLN1 protein at amino acid sequence of 110-190
  • Applications tips:
Description: A polyclonal antibody for detection of ITLN1 from Human. This ITLN1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ITLN1 protein at amino acid sequence of 110-190

ITLN1 Polyclonal Antibody

ES11184-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ITLN1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

ITLN1 Polyclonal Antibody

ES11184-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ITLN1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human Intelectin 1 (ITLN1) ELISA Kit

DLR-ITLN1-Hu-48T 48T
EUR 479
  • Should the Human Intelectin 1 (ITLN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Intelectin 1 (ITLN1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Intelectin 1 (ITLN1) ELISA Kit

DLR-ITLN1-Hu-96T 96T
EUR 621
  • Should the Human Intelectin 1 (ITLN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Intelectin 1 (ITLN1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Intelectin 1 (ITLN1) ELISA Kit

DLR-ITLN1-Mu-48T 48T
EUR 489
  • Should the Mouse Intelectin 1 (ITLN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Intelectin 1 (ITLN1) in samples from serum, plasma or other biological fluids.

Mouse Intelectin 1 (ITLN1) ELISA Kit

DLR-ITLN1-Mu-96T 96T
EUR 635
  • Should the Mouse Intelectin 1 (ITLN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Intelectin 1 (ITLN1) in samples from serum, plasma or other biological fluids.

Rat Intelectin 1 (ITLN1) ELISA Kit

DLR-ITLN1-Ra-48T 48T
EUR 508
  • Should the Rat Intelectin 1 (ITLN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Intelectin 1 (ITLN1) in samples from serum, plasma or other biological fluids.

Rat Intelectin 1 (ITLN1) ELISA Kit

DLR-ITLN1-Ra-96T 96T
EUR 661
  • Should the Rat Intelectin 1 (ITLN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Intelectin 1 (ITLN1) in samples from serum, plasma or other biological fluids.

Human Intelectin 1 (ITLN1) ELISA Kit

RDR-ITLN1-Hu-48Tests 48 Tests
EUR 500

Human Intelectin 1 (ITLN1) ELISA Kit

RDR-ITLN1-Hu-96Tests 96 Tests
EUR 692

Mouse Intelectin 1 (ITLN1) ELISA Kit

RDR-ITLN1-Mu-48Tests 48 Tests
EUR 511

Mouse Intelectin 1 (ITLN1) ELISA Kit

RDR-ITLN1-Mu-96Tests 96 Tests
EUR 709

Rat Intelectin 1 (ITLN1) ELISA Kit

RDR-ITLN1-Ra-48Tests 48 Tests
EUR 534

Rat Intelectin 1 (ITLN1) ELISA Kit

RDR-ITLN1-Ra-96Tests 96 Tests
EUR 742

Human Intelectin 1 (ITLN1) ELISA Kit

RD-ITLN1-Hu-48Tests 48 Tests
EUR 478

Human Intelectin 1 (ITLN1) ELISA Kit

RD-ITLN1-Hu-96Tests 96 Tests
EUR 662

Mouse Intelectin 1 (ITLN1) ELISA Kit

RD-ITLN1-Mu-48Tests 48 Tests
EUR 489

Mouse Intelectin 1 (ITLN1) ELISA Kit

RD-ITLN1-Mu-96Tests 96 Tests
EUR 677

Rat Intelectin 1 (ITLN1) ELISA Kit

RD-ITLN1-Ra-48Tests 48 Tests
EUR 511

Rat Intelectin 1 (ITLN1) ELISA Kit

RD-ITLN1-Ra-96Tests 96 Tests
EUR 709

ITLN1 Rabbit pAb

A7234-100ul 100 ul
EUR 308

ITLN1 Rabbit pAb

A7234-200ul 200 ul
EUR 459

ITLN1 Rabbit pAb

A7234-20ul 20 ul
EUR 183

ITLN1 Rabbit pAb

A7234-50ul 50 ul
EUR 223

ITLN1 antibody

70R-18032 50 ul
EUR 435
Description: Rabbit polyclonal ITLN1 antibody

ITLN1 Antibody

36560-100ul 100ul
EUR 252

ITLN1 antibody

10R-10234 50 ul
EUR 241
Description: Mouse monoclonal ITLN1 antibody

ITLN1 antibody

10R-10369 100 ug
EUR 435
Description: Mouse monoclonal ITLN1 antibody

ITLN1 Antibody

DF12413 200ul
EUR 304
Description: ITLN1 antibody detects endogenous levels of ITLN1.

ITLN1 Antibody

1-CSB-PA522045
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ITLN1. Recognizes ITLN1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:10000, WB:1:1000-1:5000

ITLN1 antibody

70R-8512 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal ITLN1 antibody

ITLN1 Antibody

1-CSB-PA011901GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against ITLN1. Recognizes ITLN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

ITLN1

E541-336 100ug
EUR 343

Polyclonal ITLN1 / Omentin Antibody (aa27-168)

APR08047G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ITLN1 / Omentin (aa27-168). This antibody is tested and proven to work in the following applications:

Intelectin 1 (ITLN1) Polyclonal Antibody (Mouse)

4-PAA933Mu01
  • EUR 236.00
  • EUR 2338.00
  • EUR 586.00
  • EUR 294.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ITLN1 (Arg28~Gly270)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Intelectin 1 (ITLN1)

Intelectin 1 (ITLN1) Polyclonal Antibody (Rat)

4-PAA933Ra01
  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ITLN1 (Ser101~Gly292)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Intelectin 1 (ITLN1)

ITLN1 Conjugated Antibody

C36560 100ul
EUR 397

anti- ITLN1 antibody

FNab04415 100µg
EUR 505.25
  • Immunogen: intelectin 1(galactofuranose binding)
  • Uniprot ID: Q8WWA0
  • Gene ID: 55600
  • Research Area: Immunology, Cardiovascular, Signal Transduction
Description: Antibody raised against ITLN1

Anti-ITLN1 antibody

PAab04415 100 ug
EUR 355

Anti-ITLN1 Antibody

PB10004 100ug/vial
EUR 334

Anti-ITLN1 antibody

STJ29314 100 µl
EUR 277

Anti-ITLN1 antibody

STJ192342 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ITLN1

Intelectin 1 (ITLN1) Polyclonal Antibody (Human, Mouse)

4-PAA933Hu01
  • EUR 232.00
  • EUR 2285.00
  • EUR 574.00
  • EUR 289.00
  • EUR 208.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ITLN1 (Cys31~Gly253)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Intelectin 1 (ITLN1)

Intelectin 1 (ITLN1) Polyclonal Antibody (Mouse), APC

4-PAA933Mu01-APC
  • EUR 329.00
  • EUR 3041.00
  • EUR 854.00
  • EUR 416.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ITLN1 (Arg28~Gly270)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Intelectin 1 (ITLN1). This antibody is labeled with APC.

Intelectin 1 (ITLN1) Polyclonal Antibody (Mouse), Biotinylated

4-PAA933Mu01-Biotin
  • EUR 299.00
  • EUR 2288.00
  • EUR 684.00
  • EUR 363.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ITLN1 (Arg28~Gly270)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Intelectin 1 (ITLN1). This antibody is labeled with Biotin.

Intelectin 1 (ITLN1) Polyclonal Antibody (Mouse), Cy3

4-PAA933Mu01-Cy3
  • EUR 397.00
  • EUR 4013.00
  • EUR 1097.00
  • EUR 513.00
  • EUR 241.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ITLN1 (Arg28~Gly270)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Intelectin 1 (ITLN1). This antibody is labeled with Cy3.

Intelectin 1 (ITLN1) Polyclonal Antibody (Mouse), FITC

4-PAA933Mu01-FITC
  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ITLN1 (Arg28~Gly270)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Intelectin 1 (ITLN1). This antibody is labeled with FITC.

Intelectin 1 (ITLN1) Polyclonal Antibody (Mouse), HRP

4-PAA933Mu01-HRP
  • EUR 302.00
  • EUR 2652.00
  • EUR 756.00
  • EUR 377.00
  • EUR 200.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ITLN1 (Arg28~Gly270)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Intelectin 1 (ITLN1). This antibody is labeled with HRP.

Intelectin 1 (ITLN1) Polyclonal Antibody (Mouse), PE

4-PAA933Mu01-PE
  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ITLN1 (Arg28~Gly270)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Intelectin 1 (ITLN1). This antibody is labeled with PE.

Intelectin 1 (ITLN1) Polyclonal Antibody (Rat), APC

4-PAA933Ra01-APC
  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ITLN1 (Ser101~Gly292)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Intelectin 1 (ITLN1). This antibody is labeled with APC.

Intelectin 1 (ITLN1) Polyclonal Antibody (Rat), Biotinylated

4-PAA933Ra01-Biotin
  • EUR 307.00
  • EUR 2407.00
  • EUR 714.00
  • EUR 375.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ITLN1 (Ser101~Gly292)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Intelectin 1 (ITLN1). This antibody is labeled with Biotin.

Intelectin 1 (ITLN1) Polyclonal Antibody (Rat), Cy3

4-PAA933Ra01-Cy3
  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ITLN1 (Ser101~Gly292)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Intelectin 1 (ITLN1). This antibody is labeled with Cy3.

Intelectin 1 (ITLN1) Polyclonal Antibody (Rat), FITC

4-PAA933Ra01-FITC
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ITLN1 (Ser101~Gly292)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Intelectin 1 (ITLN1). This antibody is labeled with FITC.

Intelectin 1 (ITLN1) Polyclonal Antibody (Rat), HRP

4-PAA933Ra01-HRP
  • EUR 311.00
  • EUR 2792.00
  • EUR 791.00
  • EUR 391.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ITLN1 (Ser101~Gly292)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Intelectin 1 (ITLN1). This antibody is labeled with HRP.

Intelectin 1 (ITLN1) Polyclonal Antibody (Rat), PE

4-PAA933Ra01-PE
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ITLN1 (Ser101~Gly292)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Intelectin 1 (ITLN1). This antibody is labeled with PE.

ITLN1 protein

30R-2075 100 ug
EUR 305
Description: Purified recombinant ITLN1 protein

ITLN1 Protein

20-abx262977
  • EUR 328.00
  • EUR 6425.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

ITLN1 Protein

20-abx263032
  • EUR 328.00
  • EUR 7358.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

ITLN1 siRNA

20-abx920954
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ITLN1 siRNA

20-abx920955
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Intelectin 1 (ITLN1) Antibody

20-abx177019
  • EUR 1135.00
  • EUR 551.00
  • 1 mg
  • 200 ug
  • Please enquire.

Intelectin 1 (ITLN1) Antibody

20-abx212528
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Intelectin 1 (ITLN1) Antibody

20-abx101091
  • EUR 398.00
  • EUR 133.00
  • EUR 1107.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Intelectin 1 (ITLN1) Antibody

20-abx101092
  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Intelectin 1 (ITLN1) Antibody

20-abx101093
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Intelectin 1 (ITLN1) Antibody

20-abx172967
  • EUR 787.00
  • EUR 411.00
  • 1 mg
  • 200 ug
  • Please enquire.

Intelectin 1 (ITLN1) Antibody

20-abx172968
  • EUR 843.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Intelectin 1 (ITLN1) Polyclonal Antibody (Human, Mouse), APC

4-PAA933Hu01-APC
  • EUR 323.00
  • EUR 2969.00
  • EUR 836.00
  • EUR 409.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ITLN1 (Cys31~Gly253)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Intelectin 1 (ITLN1). This antibody is labeled with APC.

Intelectin 1 (ITLN1) Polyclonal Antibody (Human, Mouse), Biotinylated

4-PAA933Hu01-Biotin
  • EUR 295.00
  • EUR 2235.00
  • EUR 671.00
  • EUR 358.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ITLN1 (Cys31~Gly253)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Intelectin 1 (ITLN1). This antibody is labeled with Biotin.

Intelectin 1 (ITLN1) Polyclonal Antibody (Human, Mouse), Cy3

4-PAA933Hu01-Cy3
  • EUR 390.00
  • EUR 3917.00
  • EUR 1073.00
  • EUR 504.00
  • EUR 239.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ITLN1 (Cys31~Gly253)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Intelectin 1 (ITLN1). This antibody is labeled with Cy3.

Intelectin 1 (ITLN1) Polyclonal Antibody (Human, Mouse), FITC

4-PAA933Hu01-FITC
  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ITLN1 (Cys31~Gly253)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Intelectin 1 (ITLN1). This antibody is labeled with FITC.

Intelectin 1 (ITLN1) Polyclonal Antibody (Human, Mouse), HRP

4-PAA933Hu01-HRP
  • EUR 297.00
  • EUR 2589.00
  • EUR 741.00
  • EUR 371.00
  • EUR 199.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ITLN1 (Cys31~Gly253)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Intelectin 1 (ITLN1). This antibody is labeled with HRP.

Intelectin 1 (ITLN1) Polyclonal Antibody (Human, Mouse), PE

4-PAA933Hu01-PE
  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ITLN1 (Cys31~Gly253)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Intelectin 1 (ITLN1). This antibody is labeled with PE.

Intelectin 1 (ITLN1) Polyclonal Antibody (Mouse), APC-Cy7

4-PAA933Mu01-APC-Cy7
  • EUR 538.00
  • EUR 5962.00
  • EUR 1588.00
  • EUR 713.00
  • EUR 304.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ITLN1 (Arg28~Gly270)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Intelectin 1 (ITLN1). This antibody is labeled with APC-Cy7.

Intelectin 1 (ITLN1) Polyclonal Antibody (Rat), APC-Cy7

4-PAA933Ra01-APC-Cy7
  • EUR 560.00
  • EUR 6286.00
  • EUR 1669.00
  • EUR 745.00
  • EUR 315.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ITLN1 (Ser101~Gly292)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Intelectin 1 (ITLN1). This antibody is labeled with APC-Cy7.

Rabbit Intelectin 1/Omentin (ITLN1) ELISA Kit

abx362579-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

ITLN1 Blocking Peptide

33R-10022 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ITLN1 antibody, catalog no. 70R-8512

ITLN1 Blocking Peptide

DF12413-BP 1mg
EUR 195

Human ITLN1 Protein

abx060058-100ug 100 ug
EUR 328
  • Shipped within 5-10 working days.

ITLN1 cloning plasmid

CSB-CL851976HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 942
  • Sequence: atgaaccaactcagcttcctgctgtttctcatagcgaccaccagaggatggagtacagatgaggctaatacttacttcaaggaatggacctgttcttcgtctccatctctgcccagaagctgcaaggaaatcaaagacgaatgtcctagtgcatttgatggcctgtattttctccg
  • Show more
Description: A cloning plasmid for the ITLN1 gene.

Intelectin 1/Omentin (ITLN1) Antibody

20-abx005461
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Intelectin 1/Omentin (ITLN1) Antibody

20-abx113197
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Intelectin 1/Omentin (ITLN1) Antibody

abx036572-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Intelectin 1/Omentin (ITLN1) Antibody

20-abx137227
  • EUR 704.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Intelectin 1 (ITLN1) Antibody (Biotin)

20-abx272759
  • EUR 425.00
  • EUR 230.00
  • EUR 1219.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Intelectin 1 (ITLN1) Antibody (Biotin)

20-abx273225
  • EUR 453.00
  • EUR 244.00
  • EUR 1288.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Intelectin 1/Omentin (ITLN1) Antibody

abx234415-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Intelectin 1/Omentin (ITLN1) Antibody

20-abx225255
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Intelectin 1 (ITLN1) Polyclonal Antibody (Human, Mouse), APC-Cy7

4-PAA933Hu01-APC-Cy7
  • EUR 527.00
  • EUR 5818.00
  • EUR 1552.00
  • EUR 698.00
  • EUR 301.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ITLN1 (Cys31~Gly253)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Intelectin 1 (ITLN1). This antibody is labeled with APC-Cy7.

ITLN1 298 a.a. Protein

20-abx260698
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Human ITLN1 ELISA Kit

ELA-E0933h 96 Tests
EUR 824

ITLN1 ELISA KIT|Human

EF000363 96 Tests
EUR 689

Human ITLN1 shRNA Plasmid

20-abx960760
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse ITLN1 shRNA Plasmid

20-abx971107
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Recombinant Intelectin 1 (ITLN1)

4-RPA933Hu01
  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q8WWA0
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 28.4kDa
  • Isoelectric Point: 7.2
Description: Recombinant Human Intelectin 1 expressed in: E.coli

Recombinant Intelectin 1 (ITLN1)

4-RPA933Mu01
  • EUR 492.45
  • EUR 235.00
  • EUR 1571.68
  • EUR 590.56
  • EUR 1081.12
  • EUR 392.00
  • EUR 3779.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O88310
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 28.7kDa
  • Isoelectric Point: 8.8
Description: Recombinant Mouse Intelectin 1 expressed in: E.coli

Recombinant Intelectin 1 (ITLN1)

4-RPA933Ra01
  • EUR 485.28
  • EUR 233.00
  • EUR 1544.80
  • EUR 581.60
  • EUR 1063.20
  • EUR 388.00
  • EUR 3712.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q499T8
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 22.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Intelectin 1 expressed in: E.coli

ITLN1 Rabbit Polyclonal Antibody

Recent Posts

Categories

January 2022
M T W T F S S
 12
3456789
10111213141516
17181920212223
24252627282930
31  

Pages