YIPF3 Rabbit Polyclonal Antibody
Contact us: [email protected]
 YIPF3 Polyclonal Antibody |
|
ABP60944-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human YIPF3 protein at amino acid sequence of N-terminal
- Applications tips:
|
|
Description: A polyclonal antibody for detection of YIPF3 from Human, Mouse, Rat. This YIPF3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human YIPF3 protein at amino acid sequence of N-terminal |
YIPF3 Polyclonal Antibody |
|
ES11368-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against YIPF3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
YIPF3 Polyclonal Antibody |
|
ES11368-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against YIPF3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
 YIPF3 Antibody |
|
1-CSB-PA863928LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against YIPF3. Recognizes YIPF3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200 |
) Polyclonal YIPF3 Antibody (C-term) |
|
APR04155G |
Leading Biology |
0.1ml |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human YIPF3 (C-term). This antibody is tested and proven to work in the following applications: |
) YIPF3 Antibody (HRP) |
|
20-abx316534 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
) YIPF3 Antibody (FITC) |
|
20-abx316535 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
) YIPF3 Antibody (Biotin) |
|
20-abx316536 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Anti-YIPF3 Antibody |
|
PA1635 |
BosterBio |
100ug/vial |
EUR 334 |
 Anti-YIPF3 antibody |
|
STJ192526 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to YIPF3 |
 YIPF3 siRNA |
|
20-abx906124 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
YIPF3 siRNA |
|
20-abx940084 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
YIPF3 siRNA |
|
20-abx940085 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 YIPF3 Antibody, HRP conjugated |
|
1-CSB-PA863928LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against YIPF3. Recognizes YIPF3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 YIPF3 Antibody, FITC conjugated |
|
1-CSB-PA863928LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against YIPF3. Recognizes YIPF3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 YIPF3 Antibody, Biotin conjugated |
|
1-CSB-PA863928LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against YIPF3. Recognizes YIPF3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 YIPF3 cloning plasmid |
|
CSB-CL863928HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1053
- Sequence: atggcaactacagcggcgccggcgggcggcgcccgaaatggagctggcccggaatggggagggttcgaagaaaacatccagggcggaggctcagctgtgattgacatggagaacatggatgatacctcaggctctagcttcgaggatatgggtgagctgcatcagcgcctgcgcg
- Show more
|
|
Description: A cloning plasmid for the YIPF3 gene. |
 Rat YIPF3 shRNA Plasmid |
|
20-abx989112 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Mouse YIPF3 shRNA Plasmid |
|
20-abx973953 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human YIPF3 shRNA Plasmid |
|
20-abx958539 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) YIPF3 Recombinant Protein (Rat) |
|
RP237731 |
ABM |
100 ug |
Ask for price |
) YIPF3 Recombinant Protein (Human) |
|
RP035026 |
ABM |
100 ug |
Ask for price |
) YIPF3 Recombinant Protein (Mouse) |
|
RP186029 |
ABM |
100 ug |
Ask for price |
 Antibody) YIP1 Family Member 3 (YIPF3) Antibody |
|
abx029177-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
YIP1 Family Member 3 (YIPF3) Antibody |
|
abx029177-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
YIP1 Family Member 3 (YIPF3) Antibody |
|
20-abx318259 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 (pORF)) Yipf3 ORF Vector (Mouse) (pORF) |
|
ORF062011 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) Yipf3 ORF Vector (Rat) (pORF) |
|
ORF079245 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) YIPF3 ORF Vector (Human) (pORF) |
|
ORF011676 |
ABM |
1.0 ug DNA |
EUR 95 |
) Yipf3 sgRNA CRISPR Lentivector set (Rat) |
|
K7162201 |
ABM |
3 x 1.0 ug |
EUR 339 |
) YIPF3 sgRNA CRISPR Lentivector set (Human) |
|
K2654701 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Yipf3 sgRNA CRISPR Lentivector set (Mouse) |
|
K3961801 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) Yipf3 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K7162202 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Yipf3 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K7162203 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Yipf3 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K7162204 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) YIPF3 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K2654702 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) YIPF3 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K2654703 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) YIPF3 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K2654704 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Yipf3 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K3961802 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Yipf3 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K3961803 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Yipf3 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K3961804 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) YIPF3 Protein Vector (Mouse) (pPB-C-His) |
|
PV248042 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) YIPF3 Protein Vector (Mouse) (pPB-N-His) |
|
PV248043 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) YIPF3 Protein Vector (Mouse) (pPM-C-HA) |
|
PV248044 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) YIPF3 Protein Vector (Mouse) (pPM-C-His) |
|
PV248045 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) YIPF3 Protein Vector (Rat) (pPB-C-His) |
|
PV316978 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) YIPF3 Protein Vector (Rat) (pPB-N-His) |
|
PV316979 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) YIPF3 Protein Vector (Rat) (pPM-C-HA) |
|
PV316980 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) YIPF3 Protein Vector (Rat) (pPM-C-His) |
|
PV316981 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) YIPF3 Protein Vector (Human) (pPB-C-His) |
|
PV046701 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) YIPF3 Protein Vector (Human) (pPB-N-His) |
|
PV046702 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) YIPF3 Protein Vector (Human) (pPM-C-HA) |
|
PV046703 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) YIPF3 Protein Vector (Human) (pPM-C-His) |
|
PV046704 |
ABM |
500 ng |
EUR 329 |
 Yipf3 3'UTR Luciferase Stable Cell Line |
|
TU122425 |
ABM |
1.0 ml |
Ask for price |
 YIPF3 3'UTR GFP Stable Cell Line |
|
TU078646 |
ABM |
1.0 ml |
EUR 1394 |
 Yipf3 3'UTR GFP Stable Cell Line |
|
TU172425 |
ABM |
1.0 ml |
Ask for price |
Yipf3 3'UTR Luciferase Stable Cell Line |
|
TU223510 |
ABM |
1.0 ml |
Ask for price |
 YIPF3 3'UTR Luciferase Stable Cell Line |
|
TU028646 |
ABM |
1.0 ml |
EUR 1394 |
Yipf3 3'UTR GFP Stable Cell Line |
|
TU273510 |
ABM |
1.0 ml |
Ask for price |
 (CMV) (pLenti-GIII-CMV)) YIPF3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
|
LV689827 |
ABM |
1.0 ug DNA |
EUR 682 |
 (UbC) (pLenti-GIII-UbC)) YIPF3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
|
LV689831 |
ABM |
1.0 ug DNA |
EUR 682 |
 (EF1a) (pLenti-GIII-EF1a)) YIPF3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
|
LV689832 |
ABM |
1.0 ug DNA |
EUR 682 |
 (UbC) (pLenti-GIII-UbC)) YIPF3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
|
LV793261 |
ABM |
1.0 ug DNA |
EUR 316 |
 (EF1a) (pLenti-GIII-EF1a)) YIPF3 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
|
LV793262 |
ABM |
1.0 ug DNA |
EUR 316 |
 GAPDH Rabbit Polyclonal Antibody |
|
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
|
37985-50ul |
SAB |
50ul |
EUR 187 |
 EFHD1 Rabbit Polyclonal Antibody |
|
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
|
38001-50ul |
SAB |
50ul |
EUR 187 |
 Alliinase Rabbit Polyclonal Antibody |
|
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
|
38042-50ul |
SAB |
50ul |
EUR 187 |
 ECFP Rabbit Polyclonal Antibody |
|
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
|
38077-50ul |
SAB |
50ul |
EUR 187 |
 EYFP Rabbit Polyclonal Antibody |
|
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
|
38078-50ul |
SAB |
50ul |
EUR 187 |
 mOrange Rabbit Polyclonal Antibody |
|
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
|
38079-50ul |
SAB |
50ul |
EUR 187 |
 mStrawberry Rabbit Polyclonal Antibody |
|
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
|
38083-50ul |
SAB |
50ul |
EUR 187 |
 AmCyan Rabbit Polyclonal Antibody |
|
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
|
38086-50ul |
SAB |
50ul |
EUR 187 |
 EBFP Rabbit Polyclonal Antibody |
|
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
|
38087-50ul |
SAB |
50ul |
EUR 187 |
 Vimentin Rabbit Polyclonal Antibody |
|
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
|
38104-50ul |
SAB |
50ul |
EUR 187 |
 LDHD Rabbit Polyclonal Antibody |
|
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
|
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
 Rabbit Hemoglobin Polyclonal Antibody |
|
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 Met Rabbit Polyclonal Antibody |
|
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
 VEGF Rabbit Polyclonal Antibody |
|
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
YIPF3 Rabbit Polyclonal Antibody
