Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG


PIP Rabbit Polyclonal Antibody

PIP Rabbit Polyclonal Antibody

Contact us: [email protected]

PIP Polyclonal Antibody

ES11389-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PIP from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

PIP Polyclonal Antibody

ES11389-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PIP from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human Prolactin Induced Protein (PIP) ELISA Kit

DLR-PIP-Hu-48T 48T
EUR 554
  • Should the Human Prolactin Induced Protein (PIP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Prolactin Induced Protein (PIP) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Prolactin Induced Protein (PIP) ELISA Kit

DLR-PIP-Hu-96T 96T
EUR 725
  • Should the Human Prolactin Induced Protein (PIP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Prolactin Induced Protein (PIP) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Prolactin Induced Protein (PIP) ELISA Kit

DLR-PIP-Ra-48T 48T
EUR 590
  • Should the Rat Prolactin Induced Protein (PIP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Prolactin Induced Protein (PIP) in samples from serum, plasma or other biological fluids.

Rat Prolactin Induced Protein (PIP) ELISA Kit

DLR-PIP-Ra-96T 96T
EUR 774
  • Should the Rat Prolactin Induced Protein (PIP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Prolactin Induced Protein (PIP) in samples from serum, plasma or other biological fluids.

Human Prolactin Induced Protein (PIP) ELISA Kit

RDR-PIP-Hu-48Tests 48 Tests
EUR 589

Human Prolactin Induced Protein (PIP) ELISA Kit

RDR-PIP-Hu-96Tests 96 Tests
EUR 820

Rat Prolactin Induced Protein (PIP) ELISA Kit

RDR-PIP-Ra-48Tests 48 Tests
EUR 631

Rat Prolactin Induced Protein (PIP) ELISA Kit

RDR-PIP-Ra-96Tests 96 Tests
EUR 880

Human Prolactin Induced Protein (PIP) ELISA Kit

RD-PIP-Hu-48Tests 48 Tests
EUR 563

Human Prolactin Induced Protein (PIP) ELISA Kit

RD-PIP-Hu-96Tests 96 Tests
EUR 783

Rat Prolactin Induced Protein (PIP) ELISA Kit

RD-PIP-Ra-48Tests 48 Tests
EUR 603

Rat Prolactin Induced Protein (PIP) ELISA Kit

RD-PIP-Ra-96Tests 96 Tests
EUR 840

PIP Rabbit pAb

A6394-100ul 100 ul
EUR 308

PIP Rabbit pAb

A6394-200ul 200 ul
EUR 459

PIP Rabbit pAb

A6394-20ul 20 ul
EUR 183

PIP Rabbit pAb

A6394-50ul 50 ul
EUR 223

PIP Polyclonal Antibody, HRP Conjugated

A55388 100 µg
EUR 570.55
Description: kits suitable for this type of research

PIP Polyclonal Antibody, FITC Conjugated

A55389 100 µg
EUR 570.55
Description: fast delivery possible

PIP Polyclonal Antibody, Biotin Conjugated

A55390 100 µg
EUR 570.55
Description: reagents widely cited

Rabbit PIP ELISA Kit

ERTP0017 96Tests
EUR 521

PIP Antibody

36498-100ul 100ul
EUR 252

PIP antibody

38874-100ul 100ul
EUR 252

PIP Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PIP. Recognizes PIP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:100-1:300

PIP Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PIP. Recognizes PIP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:100-1:300

PIP Antibody

DF7933 200ul
EUR 304
Description: PIP Antibody detects endogenous levels of total PIP.

PIP Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PIP. Recognizes PIP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

PIP Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIP. Recognizes PIP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

PIP Antibody

ABD7933 100 ug
EUR 438

PIP Antibody

ABD8001 100 ug
EUR 438

Polyclonal Goat Anti-GCDFP15 / PIP Antibody

APG00145G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-GCDFP15 / PIP . This antibody is tested and proven to work in the following applications:

Polyclonal PIP / GCDFP-15 Antibody (Internal)

APG01019G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human PIP / GCDFP-15 (Internal). This antibody is tested and proven to work in the following applications:

Human PIP Antibody

32081-05111 150 ug
EUR 261

Aquaporin PIP antibody

70R-33257 100 ug
EUR 435
Description: Rabbit polyclonal Aquaporin PIP antibody

Aquaporin PIP antibody

70R-33258 100 ug
EUR 349
Description: Rabbit polyclonal Aquaporin PIP antibody

Os-PIP Antibody

abx018466-100ul 100 ul
EUR 384
  • Shipped within 5-10 working days.

PIP Conjugated Antibody

C36498 100ul
EUR 397

Anti-PIP antibody

STJ28477 100 µl
EUR 277

Anti-PIP antibody

STJ192547 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PIP

Prolactin Induced Protein (PIP) Polyclonal Antibody (Human)

  • EUR 262.00
  • EUR 2747.00
  • EUR 679.00
  • EUR 331.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PIP (Met1~Glu146)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Prolactin Induced Protein (PIP)

Prolactin Induced Protein (PIP) Polyclonal Antibody (Mouse)

  • EUR 266.00
  • EUR 2813.00
  • EUR 694.00
  • EUR 337.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PIP (Met1~Asn146)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prolactin Induced Protein (PIP)

Prolactin Induced Protein (PIP) Polyclonal Antibody (Rat)

  • EUR 275.00
  • EUR 2958.00
  • EUR 727.00
  • EUR 350.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PIP (Met1-Asn146)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Prolactin Induced Protein (PIP)

Prolactin Induced Protein (PIP) Polyclonal Antibody (Rat)

  • EUR 275.00
  • EUR 2958.00
  • EUR 727.00
  • EUR 350.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PIP (Asn41~Thr139)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Prolactin Induced Protein (PIP)


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PIP Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIP. Recognizes PIP from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PIP Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIP. Recognizes PIP from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PIP Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIP. Recognizes PIP from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

GCDFP-15 / PIP Antibody

abx233381-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Anti-GCDFP15 / PIP antibody

STJ70914 100 µg
EUR 359

Prolactin Induced Protein (PIP) Polyclonal Antibody (Human), APC

  • EUR 368.00
  • EUR 3599.00
  • EUR 993.00
  • EUR 472.00
  • EUR 229.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PIP (Met1~Glu146)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Prolactin Induced Protein (PIP). This antibody is labeled with APC.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Human), Biotinylated

  • EUR 328.00
  • EUR 2697.00
  • EUR 786.00
  • EUR 404.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PIP (Met1~Glu146)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Prolactin Induced Protein (PIP). This antibody is labeled with Biotin.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Human), Cy3

  • EUR 449.00
  • EUR 4757.00
  • EUR 1283.00
  • EUR 588.00
  • EUR 264.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PIP (Met1~Glu146)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Prolactin Induced Protein (PIP). This antibody is labeled with Cy3.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Human), FITC

  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PIP (Met1~Glu146)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Prolactin Induced Protein (PIP). This antibody is labeled with FITC.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Human), HRP

  • EUR 335.00
  • EUR 3135.00
  • EUR 877.00
  • EUR 426.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PIP (Met1~Glu146)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Prolactin Induced Protein (PIP). This antibody is labeled with HRP.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Human), PE

  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PIP (Met1~Glu146)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Prolactin Induced Protein (PIP). This antibody is labeled with PE.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Mouse), APC

  • EUR 374.00
  • EUR 3689.00
  • EUR 1016.00
  • EUR 481.00
  • EUR 232.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PIP (Met1~Asn146)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prolactin Induced Protein (PIP). This antibody is labeled with APC.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Mouse), Biotinylated

  • EUR 332.00
  • EUR 2763.00
  • EUR 803.00
  • EUR 411.00
  • EUR 228.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PIP (Met1~Asn146)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prolactin Induced Protein (PIP). This antibody is labeled with Biotin.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Mouse), Cy3

  • EUR 457.00
  • EUR 4877.00
  • EUR 1313.00
  • EUR 600.00
  • EUR 267.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PIP (Met1~Asn146)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prolactin Induced Protein (PIP). This antibody is labeled with Cy3.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Mouse), FITC

  • EUR 319.00
  • EUR 2971.00
  • EUR 832.00
  • EUR 405.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PIP (Met1~Asn146)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prolactin Induced Protein (PIP). This antibody is labeled with FITC.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Mouse), HRP

  • EUR 341.00
  • EUR 3213.00
  • EUR 897.00
  • EUR 433.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PIP (Met1~Asn146)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prolactin Induced Protein (PIP). This antibody is labeled with HRP.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Mouse), PE

  • EUR 319.00
  • EUR 2971.00
  • EUR 832.00
  • EUR 405.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PIP (Met1~Asn146)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prolactin Induced Protein (PIP). This antibody is labeled with PE.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Rat), APC

  • EUR 388.00
  • EUR 3887.00
  • EUR 1065.00
  • EUR 501.00
  • EUR 237.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PIP (Met1-Asn146)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Prolactin Induced Protein (PIP). This antibody is labeled with APC.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Rat), Biotinylated

  • EUR 343.00
  • EUR 2908.00
  • EUR 839.00
  • EUR 425.00
  • EUR 232.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PIP (Met1-Asn146)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Prolactin Induced Protein (PIP). This antibody is labeled with Biotin.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Rat), Cy3

  • EUR 476.00
  • EUR 5141.00
  • EUR 1379.00
  • EUR 626.00
  • EUR 275.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PIP (Met1-Asn146)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Prolactin Induced Protein (PIP). This antibody is labeled with Cy3.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Rat), FITC

  • EUR 330.00
  • EUR 3129.00
  • EUR 872.00
  • EUR 420.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PIP (Met1-Asn146)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Prolactin Induced Protein (PIP). This antibody is labeled with FITC.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Rat), HRP

  • EUR 353.00
  • EUR 3385.00
  • EUR 940.00
  • EUR 451.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PIP (Met1-Asn146)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Prolactin Induced Protein (PIP). This antibody is labeled with HRP.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Rat), PE

  • EUR 330.00
  • EUR 3129.00
  • EUR 872.00
  • EUR 420.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PIP (Met1-Asn146)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Prolactin Induced Protein (PIP). This antibody is labeled with PE.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Rat), APC

  • EUR 388.00
  • EUR 3887.00
  • EUR 1065.00
  • EUR 501.00
  • EUR 237.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PIP (Asn41~Thr139)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Prolactin Induced Protein (PIP). This antibody is labeled with APC.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Rat), Biotinylated

  • EUR 343.00
  • EUR 2908.00
  • EUR 839.00
  • EUR 425.00
  • EUR 232.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PIP (Asn41~Thr139)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Prolactin Induced Protein (PIP). This antibody is labeled with Biotin.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Rat), Cy3

  • EUR 476.00
  • EUR 5141.00
  • EUR 1379.00
  • EUR 626.00
  • EUR 275.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PIP (Asn41~Thr139)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Prolactin Induced Protein (PIP). This antibody is labeled with Cy3.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Rat), FITC

  • EUR 330.00
  • EUR 3129.00
  • EUR 872.00
  • EUR 420.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PIP (Asn41~Thr139)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Prolactin Induced Protein (PIP). This antibody is labeled with FITC.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Rat), HRP

  • EUR 353.00
  • EUR 3385.00
  • EUR 940.00
  • EUR 451.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PIP (Asn41~Thr139)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Prolactin Induced Protein (PIP). This antibody is labeled with HRP.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Rat), PE

  • EUR 330.00
  • EUR 3129.00
  • EUR 872.00
  • EUR 420.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PIP (Asn41~Thr139)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Prolactin Induced Protein (PIP). This antibody is labeled with PE.

Human PIP Antibody (Biotin Conjugate)

32081-05121 150 ug
EUR 369

Prolactin-Inducible Protein (PIP) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Prolactin-Inducible Protein (PIP) Antibody

abx217780-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Prolactin Induced Protein (PIP) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Prolactin Induced Protein (PIP) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Prolactin Induced Protein (PIP) Antibody

  • EUR 467.00
  • EUR 133.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Prolactin Induced Protein (PIP) Antibody

  • EUR 481.00
  • EUR 133.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Prolactin-Inducible Protein (PIP) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Prolactin Induced Protein (PIP) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Prolactin Induced Protein (PIP) Antibody

  • EUR 481.00
  • EUR 133.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Prolactin Induced Protein (PIP) Antibody

  • EUR 926.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Prolactin Induced Protein (PIP) Antibody

  • EUR 982.00
  • EUR 495.00
  • 1 mg
  • 200 ug
  • Please enquire.

anti- GCDFP-15/PIP antibody

FNab03381 100µg
EUR 585
  • Recommended dilution: IHC: 1:20-1:200
  • Immunogen: prolactin-induced protein
  • Uniprot ID: P12273
  • Research Area: Cancer, Immunology
Description: Antibody raised against GCDFP-15/PIP

Anti-GCDFP-15/PIP antibody

PAab03381 100 ug
EUR 412

PIP Blocking Peptide

DF7933-BP 1mg
EUR 195

PIP cloning plasmid

CSB-CL018020HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 441
  • Sequence: atgcgcttgctccagctcctgttcagggccagccctgccaccctgctcctggttctctgcctgcagttgggggccaacaaagctcaggacaacactcggaagatcataataaagaattttgacattcccaagtcagtacgtccaaatgacgaagtcactgcagtgcttgcagttca
  • Show more
Description: A cloning plasmid for the PIP gene.

PIP cloning plasmid

CSB-CL018020HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 441
  • Sequence: atgcgcttgctccagctcctgttcagggccagccctgccaccctgctcctggttctctgcctgcagttgggggccaacaaagctcaggacaacactcggaagatcataataaagaattttgacattcccaagtcagtacgtccaaatgacgaagtcactgcagtgcttgcagttca
  • Show more
Description: A cloning plasmid for the PIP gene.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Human), APC-Cy7

  • EUR 616.00
  • EUR 7078.00
  • EUR 1867.00
  • EUR 824.00
  • EUR 338.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PIP (Met1~Glu146)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Prolactin Induced Protein (PIP). This antibody is labeled with APC-Cy7.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Mouse), APC-Cy7

  • EUR 628.00
  • EUR 7258.00
  • EUR 1912.00
  • EUR 842.00
  • EUR 344.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PIP (Met1~Asn146)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prolactin Induced Protein (PIP). This antibody is labeled with APC-Cy7.

Prolactin Induced Protein (PIP) Polyclonal Antibody (Rat), APC-Cy7

  • EUR 657.00
  • EUR 7654.00
  • EUR 2011.00
  • EUR 882.00
  • EUR 355.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PIP (Met1-Asn146)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Prolactin Induced Protein (PIP). This antibody is labeled with APC-Cy7.

PIP Rabbit Polyclonal Antibody

Recent Posts


January 2022
