Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG

fallback-image

PTPRF Rabbit Polyclonal Antibody

PTPRF Rabbit Polyclonal Antibody

Contact us: [email protected]

PTPRF Polyclonal Antibody

ABP60038-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human PTPRF protein
  • Applications tips:
Description: A polyclonal antibody for detection of PTPRF from Human, Mouse, Rat. This PTPRF antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PTPRF protein

PTPRF Polyclonal Antibody

ABP60038-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PTPRF protein
  • Applications tips:
Description: A polyclonal antibody for detection of PTPRF from Human, Mouse, Rat. This PTPRF antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PTPRF protein

PTPRF Polyclonal Antibody

ABP60038-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PTPRF protein
  • Applications tips:
Description: A polyclonal antibody for detection of PTPRF from Human, Mouse, Rat. This PTPRF antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PTPRF protein

PTPRF Polyclonal Antibody

ES11149-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PTPRF from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

PTPRF Polyclonal Antibody

ES11149-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PTPRF from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

PTPRF Rabbit pAb

A5444-100ul 100 ul
EUR 308

PTPRF Rabbit pAb

A5444-200ul 200 ul
EUR 459

PTPRF Rabbit pAb

A5444-20ul 20 ul
EUR 183

PTPRF Rabbit pAb

A5444-50ul 50 ul
EUR 223

PTPRF Polyclonal Conjugated Antibody

C30653 100ul
EUR 397

PTPRF Antibody

1-CSB-PA019053LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PTPRF. Recognizes PTPRF from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

PTPRF/LAR Antibody

48223-100ul 100ul
EUR 333

PTPRF/LAR Antibody

48223-50ul 50ul
EUR 239

Anti-PTPRF antibody

STJ27397 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains three Ig-like domains, and nine non-Ig like domains similar to that of neural-cell adhesion molecule. This PTP was shown to function in the regulation of epithelial cell-cell contacts at adherents junctions, as well as in the control of beta-catenin signaling. An increased expression level of this protein was found in the insulin-responsive tissue of obese, insulin-resistant individuals, and may contribute to the pathogenesis of insulin resistance. Two alternatively spliced transcript variants of this gene, which encode distinct proteins, have been reported.

Anti-PTPRF antibody

STJ192307 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PTPRF

Ptprf/ Rat Ptprf ELISA Kit

ELI-35865r 96 Tests
EUR 886

PTPRF siRNA

20-abx904376
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PTPRF siRNA

20-abx930403
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PTPRF siRNA

20-abx930404
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-PTPRF

YF-PA14212 50 ug
EUR 363
Description: Mouse polyclonal to PTPRF

anti-PTPRF

YF-PA24523 50 ul
EUR 334
Description: Mouse polyclonal to PTPRF

PTPRF/LAR Conjugated Antibody

C48223 100ul
EUR 397

PTPRF Antibody, HRP conjugated

1-CSB-PA019053LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PTPRF. Recognizes PTPRF from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PTPRF Antibody, FITC conjugated

1-CSB-PA019053LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PTPRF. Recognizes PTPRF from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PTPRF Antibody, Biotin conjugated

1-CSB-PA019053LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PTPRF. Recognizes PTPRF from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-LAR/PTPRF Antibody

PB9786 100ug/vial
EUR 334

PTPRF cloning plasmid

CSB-CL019053HU1-10ug 10ug
EUR 406
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1062
  • Sequence: atggcccctgagccagccccagggaggacgatggtgccccttgtgcctgcactggtgatgcttggtttggtggcaggcgcccatggtgacagcaaacctgtcttcattaaagtccctgaggaccagactgggctgtcaggaggggtagcctccttcgtgtgccaagctacaggag
  • Show more
Description: A cloning plasmid for the PTPRF gene.

PTPRF cloning plasmid

CSB-CL019053HU2-10ug 10ug
EUR 402
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1044
  • Sequence: atggcccctgagccagccccagggaggacgatggtgccccttgtgcctgcactggtgatgcttggtttggtggcaggcgcccatggtgacagcaaacctgtcttcattaaagtccctgaggaccagactgggctgtcaggaggggtagcctccttcgtgtgccaagctacaggag
  • Show more
Description: A cloning plasmid for the PTPRF gene.

Monoclonal antibody for LAR/PTPRF

SMC-443D 0.1mg
EUR 353
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is not conjugated.

Monoclonal antibody for LAR/PTPRF

SMC-443D-A390 0.1mg
EUR 400
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with ATTO 390.

Monoclonal antibody for LAR/PTPRF

SMC-443D-A488 0.1mg
EUR 399
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with ATTO 488.

Monoclonal antibody for LAR/PTPRF

SMC-443D-A565 0.1mg
EUR 399
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with ATTO 565.

Monoclonal antibody for LAR/PTPRF

SMC-443D-A594 0.1mg
EUR 399
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with ATTO 594.

Monoclonal antibody for LAR/PTPRF

SMC-443D-A633 0.1mg
EUR 399
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with ATTO 633.

Monoclonal antibody for LAR/PTPRF

SMC-443D-A655 0.1mg
EUR 399
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with ATTO 655.

Monoclonal antibody for LAR/PTPRF

SMC-443D-A680 0.1mg
EUR 399
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with ATTO 680.

Monoclonal antibody for LAR/PTPRF

SMC-443D-A700 0.1mg
EUR 399
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with ATTO 700.

Monoclonal antibody for LAR/PTPRF

SMC-443D-ALP 0.1mg
EUR 393
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with Alkaline Phosphatase.

Monoclonal antibody for LAR/PTPRF

SMC-443D-APC 0.1mg
EUR 398
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with APC.

Monoclonal antibody for LAR/PTPRF

SMC-443D-APCCY7 0.1mg
EUR 470
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with APC/Cy7.

Monoclonal antibody for LAR/PTPRF

SMC-443D-BI 0.1mg
EUR 395
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with Biotin.

Monoclonal antibody for LAR/PTPRF

SMC-443D-DY350 0.1mg
EUR 413
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with Dylight 350.

Monoclonal antibody for LAR/PTPRF

SMC-443D-DY405 0.1mg
EUR 402
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with Dylight 405.

Monoclonal antibody for LAR/PTPRF

SMC-443D-DY488 0.1mg
EUR 392
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with Dylight 488.

Monoclonal antibody for LAR/PTPRF

SMC-443D-DY594 0.1mg
EUR 394
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with Dylight 594.

Monoclonal antibody for LAR/PTPRF

SMC-443D-DY633 0.1mg
EUR 389
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with Dylight 633.

Monoclonal antibody for LAR/PTPRF

SMC-443D-FITC 0.1mg
EUR 391
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with FITC.

Monoclonal antibody for LAR/PTPRF

SMC-443D-HRP 0.1mg
EUR 387
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with HRP.

Monoclonal antibody for LAR/PTPRF

SMC-443D-P594 0.1mg
EUR 406
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with PE/ATTO 594.

Monoclonal antibody for LAR/PTPRF

SMC-443D-PCP 0.1mg
EUR 398
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse | Rat LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with PerCP.

Monoclonal antibody for LAR/PTPRF

SMC-443D-RPE 0.1mg
EUR 396
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse | Rat LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with RPE.

Monoclonal antibody for LAR/PTPRF

SMC-443D-STR 0.1mg
EUR 397
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse | Rat LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is conjugated with Streptavidin.

Monoclonal antibody for LAR/PTPRF

SMC-443S 0.012mg
EUR 65
  • PTPRF or leukocyte common antigen-related protein (LAR) is a widely expressed protein tyrosine phosphatase with an extracellular receptor region that resembles a cell adhesion molecule. PTPRF removes phosphate group from ?-catenin, an event that may
  • Show more
Description: A monoclonal antibody from clone S165-38 against Human | Mouse | Rat LAR/PTPRF. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 1315-1607 (cytoplasmic C-terminus) of human LAR. 97% identical in both rat and mouse. >80% identity with PTPRD and PTPRS. >50% identity with PTPRM and PTPRK.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LAR/PTPRF is not conjugated.

Protein tyrosine phosphatase receptor type F (PTPRF) polyclonal antibody

ABP-PAB-10764 100 ug Ask for price
    • Product line: Phosphatases
    • Brand:

Protein Tyrosine Phosphatase Receptor Type F (PTPRF) Polyclonal Antibody (Human)

4-PAC261Hu01
  • EUR 261.00
  • EUR 2734.00
  • EUR 676.00
  • EUR 330.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRF (Asp30~Tyr224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type F (PTPRF)

Human PTPRF ELISA KIT

ELI-22167h 96 Tests
EUR 824

Bovine PTPRF ELISA KIT

ELI-30529b 96 Tests
EUR 928

Human PTPRF ELISA Kit

ELA-E9599h 96 Tests
EUR 824

PTPRF ELISA KIT|Human

EF006526 96 Tests
EUR 689

Rat PTPRF shRNA Plasmid

20-abx990034
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse PTPRF shRNA Plasmid

20-abx972304
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PTPRF shRNA Plasmid

20-abx953914
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Ptprf ELISA KIT

ELI-35908m 96 Tests
EUR 865

Protein Tyrosine Phosphatase Receptor Type F (PTPRF) Polyclonal Antibody (Human), APC

4-PAC261Hu01-APC
  • EUR 367.00
  • EUR 3581.00
  • EUR 989.00
  • EUR 470.00
  • EUR 228.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRF (Asp30~Tyr224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type F (PTPRF). This antibody is labeled with APC.

Protein Tyrosine Phosphatase Receptor Type F (PTPRF) Polyclonal Antibody (Human), Biotinylated

4-PAC261Hu01-Biotin
  • EUR 327.00
  • EUR 2684.00
  • EUR 783.00
  • EUR 403.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRF (Asp30~Tyr224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type F (PTPRF). This antibody is labeled with Biotin.

Protein Tyrosine Phosphatase Receptor Type F (PTPRF) Polyclonal Antibody (Human), Cy3

4-PAC261Hu01-Cy3
  • EUR 447.00
  • EUR 4733.00
  • EUR 1277.00
  • EUR 585.00
  • EUR 263.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRF (Asp30~Tyr224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type F (PTPRF). This antibody is labeled with Cy3.

Protein Tyrosine Phosphatase Receptor Type F (PTPRF) Polyclonal Antibody (Human), FITC

4-PAC261Hu01-FITC
  • EUR 313.00
  • EUR 2884.00
  • EUR 811.00
  • EUR 396.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRF (Asp30~Tyr224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type F (PTPRF). This antibody is labeled with FITC.

Protein Tyrosine Phosphatase Receptor Type F (PTPRF) Polyclonal Antibody (Human), HRP

4-PAC261Hu01-HRP
  • EUR 334.00
  • EUR 3120.00
  • EUR 873.00
  • EUR 424.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRF (Asp30~Tyr224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type F (PTPRF). This antibody is labeled with HRP.

Protein Tyrosine Phosphatase Receptor Type F (PTPRF) Polyclonal Antibody (Human), PE

4-PAC261Hu01-PE
  • EUR 313.00
  • EUR 2884.00
  • EUR 811.00
  • EUR 396.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRF (Asp30~Tyr224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type F (PTPRF). This antibody is labeled with PE.

PTPRF Interacting Protein Alpha 3 (PPFIA3) Antibody

20-abx114880
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

PTPRF Rabbit Polyclonal Antibody

Recent Posts

Categories

January 2022
M T W T F S S
 12
3456789
10111213141516
17181920212223
24252627282930
31  

Pages