Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG

fallback-image

NR5A2 Rabbit Polyclonal Antibody

NR5A2 Rabbit Polyclonal Antibody

Contact us: [email protected]

NR5A2 Polyclonal Antibody

ES11124-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NR5A2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

NR5A2 Rabbit pAb

A13688-100ul 100 ul
EUR 308

NR5A2 Rabbit pAb

A13688-200ul 200 ul
EUR 459

NR5A2 Rabbit pAb

A13688-20ul 20 ul
EUR 183

NR5A2 Rabbit pAb

A13688-50ul 50 ul
EUR 223

NR5A2 Rabbit pAb

A5766-100ul 100 ul
EUR 308

NR5A2 Rabbit pAb

A5766-200ul 200 ul
EUR 459

NR5A2 Rabbit pAb

A5766-20ul 20 ul
EUR 183

NR5A2 Rabbit pAb

A5766-50ul 50 ul
EUR 223

NR5A2 Rabbit pAb

A16854-100ul 100 ul
EUR 308

NR5A2 Rabbit pAb

A16854-200ul 200 ul
EUR 459

NR5A2 Rabbit pAb

A16854-20ul 20 ul
EUR 183

NR5A2 Rabbit pAb

A16854-50ul 50 ul
EUR 223

NR5A2 antibody

20R-A2453 50 ug
EUR 656
Description: Rabbit polyclonal NR5A2 antibody

NR5A2 Antibody

33028-100ul 100ul
EUR 252

NR5A2 Antibody

DF8470 200ul
EUR 304
Description: NR5A2 Antibody detects endogenous levels of total NR5A2.

NR5A2 Antibody

1-CSB-PA016066LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NR5A2. Recognizes NR5A2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200

NR5A2 Antibody

ABD8470 100 ug
EUR 438

Polyclonal Mouse Nr5a2 Antibody (Center)

APR17831G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Mouse Nr5a2 (Center). This antibody is tested and proven to work in the following applications:

Polyclonal NR5A2 / LRH1 Antibody (internal region)

APG02944G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human NR5A2 / LRH1 (internal region). This antibody is tested and proven to work in the following applications:

Polyclonal Nr5a2 Antibody - C-terminal region

APG02945G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Nr5a2 - C-terminal region. This antibody is tested and proven to work in the following applications:

NR5A2 Conjugated Antibody

C33028 100ul
EUR 397

anti- NR5A2 antibody

FNab05848 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • Immunogen: nuclear receptor subfamily 5, group A, member 2
  • Uniprot ID: O00482
  • Gene ID: 2494
  • Research Area: Signal Transduction, Metabolism, Developmental biology
Description: Antibody raised against NR5A2

Anti-NR5A2 antibody

PAab05848 100 ug
EUR 386

Anti-NR5A2 antibody

STJ28333 100 µl
EUR 277
Description: The protein encoded by this gene is a DNA-binding zinc finger transcription factor and is a member of the fushi tarazu factor-1 subfamily of orphan nuclear receptors. The encoded protein is involved in the expression of genes for hepatitis B virus and cholesterol biosynthesis, and may be an important regulator of embryonic development.

Anti-NR5A2 antibody

STJ115643 100 µl
EUR 277
Description: The protein encoded by this gene is a DNA-binding zinc finger transcription factor and is a member of the fushi tarazu factor-1 subfamily of orphan nuclear receptors. The encoded protein is involved in the expression of genes for hepatitis B virus and cholesterol biosynthesis, and may be an important regulator of embryonic development.

Anti-NR5A2 antibody

STJ119222 100 µl
EUR 277

Anti-NR5A2 antibody

STJ192282 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NR5A2

Anti-NR5A2/Lrh 1 Rabbit Monoclonal Antibody

M01332 100ug/vial
EUR 397
Description: Rabbit Monoclonal NR5A2/Lrh 1 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Polyclonal NR5A2 / LRH-1 Antibody (C-Terminus)

APG02943G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NR5A2 / LRH-1 (C-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal NR5A2 / LRH-1 Antibody (aa1-67)

APR11151G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NR5A2 / LRH-1 (aa1-67). This antibody is tested and proven to work in the following applications:

NR5A2 siRNA

20-abx903654
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NR5A2 siRNA

20-abx926359
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NR5A2 siRNA

20-abx926360
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NR5A2 Antibody, HRP conjugated

1-CSB-PA016066LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NR5A2. Recognizes NR5A2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NR5A2 Antibody, FITC conjugated

1-CSB-PA016066LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NR5A2. Recognizes NR5A2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NR5A2 Antibody, Biotin conjugated

1-CSB-PA016066LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NR5A2. Recognizes NR5A2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

NR5A2 recombinant monoclonal antibody

A5795 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human NR5A2 for WB,ELISA

Anti-NR5A2/LRH1 Antibody

PB9298 100ug/vial
EUR 294

Anti-NR5A2 / LRH1 antibody

STJ73058 100 µg
EUR 359

NR5A2 Blocking Peptide

DF8470-BP 1mg
EUR 195

NR5A2 cloning plasmid

CSB-CL016066HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1488
  • Sequence: ATGTCTTCTAATTCAGATACTGGGGATTTACAAGAGTCTTTAAAGCACGGACTTACACCTATTGTGTCTCAATTTAAAATGGTGAATTACTCCTATGATGAAGATCTGGAAGAGCTTTGTCCCGTGTGTGGAGATAAAGTGTCTGGGTACCATTATGGGCTCCTCACCTGTGAAA
  • Show more
Description: A cloning plasmid for the NR5A2 gene.

anti-NR5A2 / LRH1

YF-PA23740 50 ul
EUR 334
Description: Mouse polyclonal to NR5A2 / LRH1

Anti-NR5A2 / LRH1 (aa328-338) antibody

STJ72073 100 µg
EUR 359

NR5A2 ELISA KIT|Human

EF001321 96 Tests
EUR 689

NR5A2 Rabbit Polyclonal Antibody

Recent Posts

Categories

January 2022
M T W T F S S
 12
3456789
10111213141516
17181920212223
24252627282930
31  

Pages